Australia: Myriad Gene Patents Look Good

Guest post by Ben McEniery.  McEniery is a Senior Lecturer in Law at the Queensland University of Technology and a Barrister who specialises in Intellectual Property Law matters.

On Friday the Full Court of the Federal Court of Australia in D’Arcy v Myriad Genetics Inc [2014] FCAFC 115 upheld the validity of Myriad Genetics’ Australian BRCA1 gene patent over isolated DNA sequences.

The five judges who constituted the court in a joint judgment unanimously held that isolating a DNA sequence from its surrounding genetic material involves more than simply taking the nucleic acid out of the cell, and instead involves structural and functional changes that create a new composition of matter. The court thus took the view that the patent in question claims something other than subject matter that had previously existed in nature, and as such, the isolated nucleic acid, including cDNA, constitutes patentable subject matter.

The expressly court rejected the conclusion reached last year by the US Supreme Court in AMP v Myriad Genetics that isolated genes and the information they encode are not patent eligible. Instead, it adopted the reasoning of Judges Lourie and Moore in the Federal Circuit below, finding that isolated genes are not naturally-occurring substances but are “the products of man”. At paragraph [212] the court said that:

What is being claimed is not the nucleic acid as it exists in the human body, but the nucleic acid as isolated from the cell. The claimed product is not the same as the naturally occurring product. There are structural differences but, more importantly, there are functional differences because of isolation.

Although the court characterised isolated DNA as material derived from naturally occurring material, it held that this is not a reason for it to be excluded from patentability. In this regard, the court by reference to precedent explained the distinction between a discovery (and an idea in the abstract) and an invention at paragraphs [111] to [113]. The court thus took the view that in determining whether an invention is patentable subject matter, there is no requirement for a consideration of whether a claimed composition of matter is a “product of nature” or whether a microorganism is “markedly different” from something that already exists in nature. The court also noted at paragraph [155] that “the analysis should focus on differences in structure and function effected by the intervention of man and not on the similarities [with what is found in nature]”.

The court, for the purposes of Australian law, sought to delineate patentable and non-patentable subject matter by stating that, “[a] mere discovery is not patentable and an idea is not patentable, but a “manner of manufacture”, as that term has been developed, is.” In doing so, the court rejected any suggested that there is a “product of nature” subject matter exclusion in Australian law.

Unlike the US Supreme Court, the Full Federal Court considered that the correct approach when determining patentable subject matter is to focus on the products of human ingenuity claimed (in this instance being the isolated nucleotide sequences) and not on the information that they contain. In this regard, the court criticised the US Supreme Court noting at paragraph [215] that:

It is difficult to reconcile that Court’s endorsement of the reasoning in Chakrabarty, with its rejection of isolated nucleic acid as eligible for patentability. With respect, the Supreme Court’s emphasis on the similarity of ‘the location and order of the nucleotides’ existing within the nucleic acid in nature before Myriad found them is misplaced. It is the chemical changes in the isolated nucleic acid which are of critical importance, as this is what distinguishes the product as artificial and economically useful.

Unlike in places such as the United States and Canada where subject matter eligibility is defined by reference to enumerated classes of subject matter, the scope of patentable subject matter in Australia is defined by reference to whether an invention is a “manner of manufacture” of the kind envisaged by s 6 of the Statute of Monopolies 1623.

While it is difficult to fault the Full Federal Court’s reasoning, it is unlikely that this will be the final chapter in Myriad’s defense of its Australian patent. Rather, it is likely that the unsuccessful applicant in this instance will appeal to the High Court of Australia, Australia’s final court of appeal, and that that the High Court will give leave (a statutory equivalent to certiorari) to hear the appeal given the importance of the subject matter concerned.

Dennis Crouch

About Dennis Crouch

Law Professor at the University of Missouri School of Law. Co-director of the Center for Intellectual Property and Entrepreneurship.

48 thoughts on “Australia: Myriad Gene Patents Look Good

  1. There were certainly some major revolutionary changes in technology between the time that the first “isolated” DNA sequences were claimed (many, many years ago) and the US Supreme Court’s Myriad decision. I think if the US Supreme Court had addressed these changes directly and matter of factly they would have ended up with a more coherent and effective holding than the decision they actually wrote.

    I’ve seen a couple of references made to claims directed to non-DNA non-naturally occuring structurally defined biomolecules being declared ineligible at the PTO, not because the molecules were “similar” to any molecule that had been previously described or subsequently found in nature, but because the molecules (e.g., antibodies) were synthesized by a “natural” organism reacting to a man-made event. That reasoning would seem to leap waaaaaay beyond anything found in any Supreme Court case.

    News flash, folks: we’re all part of “nature” and that’s not going to change. Everything that happens occurs as the result of something else happening “naturally”. The mere involvement of a “natural” event or law somewhere in a synthesis process can’t possibly be the test for eligibility of a new, non-naturally occuring molecule made by that process. I think the Breyer made that abundantly clear in Mayo v. Prometheus because he knew that if he didn’t some desperate person would grab the football and run out of the stadium.

    Is anyone aware of a specific example of such a rejection? I’m curious about the structural specificity of the rejected claim.

    1. MM, when the PTO posted its guidelines, I remarked instantly that it appeared that they simply did not get or understand Myriad.

      The question on the table, for 101 purposes, is whether the claim is to a composition that is not new regardless that it is not known. The Office needs to carry the burden here, and it makes or should make no difference at all whether the isolation techniques are old if the resulting chemical composition is, in fact, new.

      Stick a tree in at one end, process, and out comes paper. It makes no difference here that a tree in a product of nature.

      1. The closer is analogy is a “new” method that used trained bark boring beetles to sculpt a tree into a new, distinct baseball bat.

  2. jesse products of nature are public domain

    As are all of the synthetic man-made compositions in the prior art. But the information in the prior art is very different from some future discovery made for the sole purpose of rendering a granted claim to such a structure ineligible (the circumstance in my hypothetical) so the underlying policy must be different.

    Historically, when we evaluated a new non-natural structure for patentability, we used 102/103 and the utility prong of 101 and that seemed to work just fine.

    Were there changes in technology that necessitated this decision? I think if the Supreme Court had addressed this issue matter of factly they would have ended up with a more coherent and effective holding than the one they wrote.

    1. Quite possibly. But that would have required them to understand the chemistry as well. Lawyers and judges have not been that good at technology (as in understanding the foundations) of what they are ruling over.

      Sometimes they get it right… sometimes not. And when they mis they seem to miss by a wide margin.

  3. Think the Australian Court got it right. Focus should be on ingenuity not on what really is our own Supreme Court’s abstract idea.

  4. The difference between the US and Australia is based on different underpinning factual findings.

    The Australian court took the claim wording as it stands and treated the claim to genuinely isolated molecules. And the claim was to mutated sequences, not normal sequences as in the US.

    In the US in relation to the full length BRCA1 gene, the Court disbelieved that the molecule had actually been isolated or that its sequence was known (only about 27,000 of the 81,000 nucle0tides were known). Much existed in silico rather than in a test tube. That is one of the underlying reasons why the US Court made the finding that it did.

    As the difference has more to do with underlying fact than legal principles, it is arguable that leave to appeal should not be given, especially as there were concurrent findings below.

    1. The difference between the US and Australia is based on different underpinning factual findings.

      Couple questions for Paul or the authors of this piece:

      1) Have the particular claims asserted in this Australian case been challenged by a third party or the Australian PTO on any other basis than subject matter eligibility in Australia?

      2)Were there claims more similar to the US claims that were asserted or prosecuted in Australia which were tanked as anticipated, lacking an inventive step or for being too broad?

  5. As to “isolated” I am reminded of the comments of an English patents judge some years ago, about leaves in the Brazilian rain forest. If you want to hide a leaf, where better to hide it than in the rain forest of Brazil?

    Suppose there is only one leaf in the forest, that carries the unique code, that delivers a life-saving function. That leaf is going to be hard to find. And now, if I say I have “isolated” that one leaf, what does that mean? At what point is that leaf “isolated”?

    Does “isolate” mean one thing when talking about that one leaf in the forest, but quite another in the context of the DNA book and the leaf in it that Myriad “isolated”? Do you have to tear out the page or is it enough to flag it? How significant to patentability is the tearing out of the page?

    1. For “isolated” you need real material in a test tube. I do not think that “isolated” covers a sequence in computer memory only.

      And this is not really like leaves in a forest. The chromosome is a linear sequence, like a road. So what is essentially claimed is the stretch of the A! between Stamford and Grantham.

      1. For “isolated” you need real material in a test tube. I do not think that “isolated” covers a sequence in computer memory only.

        I agree with you but I think MD was just speaking figuratively about genomes, not referring to an actual book …

        So what is essentially claimed is the stretch of the A! between Stamford and Grantham.

        Except that (1) the claim expressly excludes the pre-existing road you’re referring to because the pre-existing road is not “isolated” ; and (2) you can do a lot of incredibly useful stuff with the “isolated” road that you can’t do with the pre-existing road, like drive up the side of a mountain comprising the “isolated” road and avoid Grantham and Stamford altogether.

        1. I was speaking figuratively, indeed. Thanks MM. The A1 might be long in the context of Roman Roads in Great Britain, but I suspect human DNA has orders of magnitude more units in it than the length of the entire A1, not just expressed in rods, poles, perches but even in inches.

          1. These figures are well known, Max. The human genome is about three billion base pairs. Each base pair in B-DNA (the usual conformation) is about .33 nanometers deep. So a whole human genome is about 1 meter long, in each cell of your body (if you are a human; other species may vary).

            The A1 is 660km long according to Wik. In inches, 660km is about 25 million or 1% of the number of nucleotides in the human genome.

      2. Thanks Paul. Not sure whether “in a test tube” is the definitive test, but almost.

        Suppose Google Earth becomes good enough to image every single leaf in Brazil, store the gazillion images in memory and print any one you want. The invention as I see it lies in specifying which specific leaf to print, and why.

        If you have it in a test tube, but don’t know why, have you “isolated” it and if you have, is that enough to be an Invention?

        1. In the main no. You have to know not only what has been isolated but also what its utility is. I do not do universal rules, and there may be situations where what has been said is wrong, but what I have said is a useful working rule.

          And it is worth looking at Professor Luigi Palombi’s thesis, submitted as one of the Myriad-Mayo Guidance comments. We may not agree with him, but he has done a lot of work developing his line of argument.

  6. >>if they claim the exact structure of the isolated compound.

    I believe US practitioners should be able to claim new furniture as long as they claim the height to the 1/10,000 of an inch without ranges.

    1. Night, there are some practitioners in the US who know that just because a law of physics specifies that the information content of the universe is preserved that the information that is preserved is non abstract such that information processing involving that law of physics actually requires one to operate on non abstract information.

      1. Ned >>”non abstract information”

        Please do tell us what the definition of abstract is to a physicist.

    2. I think that NWPA’s point here is fair and accurate that the laws of physics do not offer any real dividing line between what is abstract/functional and what is not abstract down to the sub-atomic level. See link to xkcd.com (Turtles all the way down). Of course, there must be a dividing line in the law lest the rule swallow all of patent law. The Supreme Court is clearly focused on the scale of human technology and scientific research and identifies the problem as being patents that prevent others from accessing the building blocks of science and technology. This would suggest that minor abstractions (such as claiming a narrow range instead of a precise value) would not be problematic. On the other hand, the court has also been very clear that the narrowness of the abstraction does not matter and cannot be used to support patent eligibility.

      1. Dennis, I think that NWPA’s point here is fair and accurate that the laws of physics do not offer any real dividing line between what is abstract/functional and what is not abstract down to the sub-atomic level.

        I don’t think that’s Night’s point at all. He cites a law of physics that operates on the real physical universe; and because that law of physics includes the word “information,” he then makes a leap that any information processing should be eligible subject matter even when the only common thing between the two is the word information.

        In the physical world, information describes a state of the world and conservation requires that the progress from one state to another be reversible.

        However Night would like information processing to include the world of fiction and fantasy such that processing information involving price, or the amount of grace one achieves from saying five Hail Marys, and the like, are patentable just because they process information. Trust me, the land of fiction and fantasy have nothing to do with the laws of physics.

        Thus when I ask him to tell me when an algorithm calculates a number, I give the number precisely, 46, whether 46 is the price of tea in China, the number of dogs in India, or the like, he refuses to answer the question. What that number represents is abstract – a thing of the mind.

        Alternatively when Night claims that a program provides new structure to the computer, I ask him to define or describe the structure of a “one.” He just calls me names in response.

        To be patentable, information processing must operate on the real world. It must take inputs, process them, and provide outputs to the real world as the process claims in Diehr. If one is just processing the fantasy world or the fictional world, one is not operating in the physical world at all.

  7. It seems the court gave must have given “structural” weight to “isolated.” The US Supreme Court looked instead at the functional definition, defining structure in terms of what it did while giving no weight to “isolated.”

    I think practitioners in the US should be able to claim isolated DNA if they claim the exact structure of the isolated compound.

    1. Would that mean you could patent a grain of sand if you “claim the exact structure of the isolated” grain of sand?

      1. Would that mean you could patent a grain of sand if you “claim the exact structure of the isolated” grain of sand?

        It doesn’t seem like the right answer is “yes”, does it? Pick a grain of sand and claim it. But you also have to have some specific, substantial and credible utility — more specific and substantial than an expressed sequence tag’s utility (which are pretty specific and substantial compared to your typical sand grain), at least, if you want to get past the Federal Circuit. Application of that 101 prong alone would seem to take care of nearly all “grain of sand” type inventions.

        What if I invent a machine that accurately and reproducibly makes a silicon particle with a specific structure, where that structure is previously undescribed? The structure of the particle confers it with unexpected and extremely useful properties. I claim the structure of the particle very specifically in objective structural terms.

        After I get my patent and sue you because you are making my particle with your improved machine, you hire a team of experts. One of them “discovers”, near the summit of Old Sand Mountain, a single grain of silicon that falls within the scope of my claim after the expert “isolates” it (none of the 4 trillion other grains infringe). What happens to my patent? Ineligible? Why? What’s the policy driving that result?

        1. It looks like you may be claiming two inventions – one to make the grain of sand, then the grain of sand itself.

          If you are claiming the machine itself and mine would be an “improvement” of yours – If mine is derived from yours it would appear to be an infringement on yours.

          Now if my machine searches (ie. doesn’t make) for a particular grain of sand, it would be a new machine, and thus doesn’t infringe your patent.

          If you are claiming the specific grain of sand as your invention, it would seem reasonable that the invention of the “grain of sand” would or should be invalidated as it has been shown to be a product of nature.

          1. I’m just talking about claims to the particle, not claims to the machine or method.

            If you are claiming the specific grain of sand as your invention, it would seem reasonable that the invention of the “grain of sand” would or should be invalidated as it has been shown to be a product of nature.

            Okay. But as applied to these facts, what’s “reasonable” about this “product of nature” rule? Nobody would have known how to make it, nor would anyone have had any reason to “isolate” this specific particle from Old Sand Mountain if I hadn’t first described its structure in detail (in objective structural terms) and it’s useful properties in a patent, and then sued you for synthesizing it with your machine.

            What policy is being promoted by this kind of result? Seems weird to me.

              1. sorry, this should have been included above…

                And you wouldn’t be able to sue someone for a machine that made the exact same grain of sand.

                Anyone could have found that sand – no inventive step, other than the machine that aided the search.

                Now once that machine was found, then searching for other grains of sand that are useful would become trivial.

              2. Not patenting creations of nature…

                I think that’s the result/conclusion, jesse, not the underlying policy.

                If the question is “what is the policy underlying the law against people doing X”, it’s not responsive to state the policy is “preventing people from doing X”.

                1. Or,

                  Products of nature are not owned by anyone.

                  I’m sure there is a legalese way of saying that, or calling products of nature are public domain.

    2. I seem to recall that some of Myriad’s nucleic acid claims that were tanked were “consisting of” claims, i.e., claims to a single unambiguous structure set forth in claim by reference to a sequence listing.

      The extra weirdness there, of course, is that everyone knows that the genomic DNA of mammals (e.g., humans) in vivo is itself modified by methylation as a means for controlling gene expression. In bacteria — the most abundant type of lifeform on Earth — DNA modification is used by the cell for regulation of replication and repair, and also as a primitive system for restricting the replication of foreign DNA introduced into the cell.

      I agree that the Australian court accepted the argument that the claimed isolated molecules, because they were isolated from the entire genome and were therefore structurally distinct from the genome, were “not found in nature” and that pretty much settled the question in Australia as to whether they were ineligible “natural products.”

      The US Supreme Court wasn’t satisfied with that finding, although they certainly made it: “Nor are Myriad’s claims saved by the fact that isolating DNA from the human genome severs chemical bonds and thereby creates a nonnaturally occurring molecule.” Got that? Now remember tht each of Myriad’s nucleic acid composition claims at issue recited the term “isolated”. Presumably, then, the molecules covered by the claims were “non-natural.” So how to find the claims ineligible? The US Supreme Court’s answer was apparently to go after the rest of the claim (the non-isolated part) which it did in one sentence. That sentence consisted of two inaccurate and contradictory statements:

      1) “Myriad’s claims are simply not expressed in terms of chemical composition…”

      That is arguably true of some of Myriad’s claims if you interpret the “encoding” language functionally. The counterargument is that if we assume the code referred to is the standard genetic code — a reasonable assumption — then the claims are no less structural than any other chemical structure described by reference to its atomic configuration. A, G, T, and C (for example) are abbreviations for chemicals of known structure, after all.

      But, more importantly, some of Myriad’s claims before the Supreme Court did not rely on encoding language (e.g., claim 7 of the ‘282 patent link to patentdocs.org),
      but recited base-by-base specific polynucleotides whose chemical structures are plainer than paint on a wall. One could copy the description of the molecule right out of the patent (along with the recited sequence listing), tell 500 different labs to synthesize it for you, and you’d end up with 500 identical molecules.

      But what about the other half of this sentence?

      2) nor do [Myriad’s claims] rely in any way on the chemical changes that result from the isolation of a particular section of DNA”.

      First of all, to the extent all of the claims recite “isolated” DNA and the court has already admitted (in the previous sentence!) that “isolating DNA from the human genome severs chemical bonds and thereby creates a non-natural molecule”, there certainly must be some “chemical change”.

      More specifically, how does claim 7 of the ‘282 patent, which describes three unambiguous chemical structures in pure structural terms, “not rely in any way on chemical changes that result from the isolation of a particular section of DNA”? What could the term “rely on” possibly mean in the context of claim 7, when “isolation” necessarily results in a “chemical change” (severed bonds) relative to the natural DNA and where the structure of the molecule is claimed in unambiguous objective structural terms?

      None of this is to say I liked Myriad’s claims, even from an eligibility standpoint. I just find it odd that (if you follow the Supreme Court’s logic and the distinction they are trying to make)

      1) aaaaatctaaaaatctaaaatcttatt is ineligible but
      2) gaaaaatctaaaaatctaaaatcttatgt is eligible
      in view of natural sequence
      3) gaaaaatctaaaaatctaaaatcttattt

      It raises the strange question as to what other “chemical differences” between two molecules (one “invented” and one found “in nature”) are more like the differences between (1) and (3) than between the differences in (2) and (3). Answering that question may get very messy very quickly. Do we need to count the number of atoms the molecules have in common or …?

      1. :) or a ratio of the differences between the product of nature and the product of the lab.

        Not being a biochemist, I would tend to want to check with experts in the field for what the molecule actually does, how it is manufactured/manipulated in nature…

        After all, even a cold virus can isolate genes, and modify DNA sequences… all being a product of nature. And it is, as I understand it, perfectly natural for genes to fold in different ways – some enable expression, some disable it, all done in nature.

        1. I would tend to want to check with experts in the field for what the molecule actually does, how it is manufactured/manipulated in nature…/i>

          And that gets weighed in somehow along with the structural differences? Even if “what it does in nature” and “how it’s manufactured in nature” isn’t known until years after I first describe, synthesize, and demonstrate a utility for the molecle, and claim it in such a way that the claim covers only non-natural compositions?

          Or is the important issue really how I arrived at my synthesis scheme?

          1. I don’t think it should matter how the product is arrived at – once it is shown to be a product of nature, nature should void any patent on it. If the method is one of nature, then the method should not be patented. But a machine that can replicate the product shouldn’t be a problem, though the method used by the machine might not be protected. Of course, if that machine is also a product of nature, then that should preclude patenting it.

            Now, UNTIL it is shown to be a product of nature is a different thing. I know that introduces a point of contention – does the inventor know of the product of nature before the patent grant… That is most likely depending on the honesty of the applicant.

            1. I don’t think it should matter how the product is arrived at – once it is shown to be a product of nature, nature should void any patent on it.

              And my question remains: what is the policy justification for this (in my opinion) extreme rule and the even more extreme rule we have now in the US that even non-natural products (like the compositions at issue in Myriad) are excluded?

              It seems that some of the same policy concerns that drove the result in the Myriad case could be much better addressed by a different scheme which would reward inventors who claim products similar to those found “in nature” without tying up those “basic building blocks.”

              1. THAT is the problem.

                When there is no difference between the products from the company and those found in nature, then there shouldn’t be a patent . Similar shouldn’t mean identical.

                If there is a difference, then I should think it reasonable to patent, after all, it isn’t exactly the same, even if the chemical effect is the same. Personally, I would expect there to be a difference in molecular weight between the manufactured chemical, and that found in nature.

              2. MM, “Policy concerns…. drove ….”

                Ah, come on now. Please.

                In 1790, the statutes provided that one may obtain a patent for a useful machine, etc., not before known or used.

                Without deleting “known or used,” Jefferson added in 1793 both “new” and “composition.” New would have been redundant if known or used were sufficient.

                Now, why in the freaking world did Jefferson add “new” to the statute if known or used were sufficient?

                DNA was not found ineligible because it was otherwise statutory and had to be excluded due to policy. It was found to be nonstatutory because it was not a “new composition” within the meaning of 101 regardless that it was not previously known.

      2. Thanks MM –

        Many folks, including the DOJ/PTO have argued for a unitary approach to eligibility exclusions. In that scenario, we would simply follow Mayo/Alice and ask whether the difference between the invention & natural phenom itself contains a sufficient inventive concept. Here, I would suggest that using a well known technique to alter the sequence (for a well known purpose and with predictable results) does not offer an inventive concept. Of course . . . that is not the approach used by the Supreme Court in Myriad.

        DC

        1. Dennis – mercifully that wasn’t the approach used by the Supreme Court, because it would have swallowed even more of biotechnology than it did. Assume: researcher identifies novel and nonobvious anesthetic compound X in an obscure deep-sea conch. Then makes a conventional chemical change to predictably increase the compound’s solubility. Then makes it synthetically in the lab instead of extracting it from the conch. Then formulates it with conventional pharmaceutical excipients. In tablet form. At a dose of 200mg/kg. None of this would be patent-eligible: “isolated substance X;” “modified substance X;” “synthetic substance X;” “a pharmaceutical formulation comprising substance X and one or more excipients;” “a tablet comprising substance X;” “a method of treating pain in a subject comprising administering substance X at a dose of 200mg/kg;” – all of these claims could meet 102, 103 and 112, and 101-utility, yet could be deemed to lack an “inventive concept” because they all depend on the discovery of substance X. Absent the discovery of substance X, the inventor could be said to “have invented nothing.” Yet — new drug tablets just don’t grow on trees. Why should we suddenly deny patents on antibiotics, vaccines, industrial enzymes, medicinal molecules and so many other inventions, even if they’re claimed so narrowly as to NOT preempt people from using the naturally-extracted substance? What policy rationale is being advanced by such a theory?

          1. The simple answer is that the drugs would be cheaper.

            The manufacturing would still be a trade secret… so the manufacturer still gets a big/huge head start.

            But it would not prevent other manufacturers from doing it, possibly cheaper, and thus save more lives.

        2. Dennis: Many folks, including the DOJ/PTO have argued for a unitary approach to eligibility exclusions.

          I understand the desire for that but I think it’s too great of a stretch given the fundamental differences between method claims, on one hand, and structurally distinct and defined physical objects (apparati, compositions) on the other hand. Trying to find a “unitary theory”, I believe, is likely to break the theory and make it more difficult to apply than separate theories which direct the fundamentally different kinds of claims that applicants pursue.

          In that scenario, we would simply follow Mayo/Alice and ask whether the difference between the invention & natural phenom itself contains a sufficient inventive concept.

          Right away I have a problem because structures are structures. A new chemical described structurally doesn’t “contain” an “inventive concept” in the manner that, say, Prometheus’ determine-and-infer claims “contained” a concept (i.e., the inference itself which was recited in the claim).

          I would suggest that using a well known technique to alter the sequence (for a well known purpose and with predictable results) does not offer an inventive concept.

          That’s pure 103, isn’t it? 103 (and 102) are perfectly suited to examining claims that recite a new structure in structural terms. It’s understood that such structures are going to made in absolute accordance with the laws of nature and, in many cases, with conventional tools. The analysis has been used reliably for ages, around the world, including the key consideration of the unexpected useful properties of that claimed structure.

          That’s not true, however, for claims that purport to protect “new” information (e.g., Prometheus’ claims) or “new” logical information processing steps.

        3. Dennis, there might be a nuance between claiming something otherwise statutory that is not new albeit not known or used, and something that is new albeit non statutory.

          We best not mix concepts.

      3. mm, this reminds one of Benson’s claim that included a shift register. That flummoxed people who were trying to understand.

        I think the Supreme Court focused on the functionally claimed claims — claims that produced X molecule, where X molecule was the same as that produced in nature. What produced X molecule was the active sequence common to both isolated and wild DNA.

Comments are closed.