By Dennis Crouch
Association for Molecular Pathology v. Myriad Genetics, 12-398 (Supreme Court 2013) oral argument transcript.
The Supreme Court held oral arguments today in the much watched Gene patent case pending before the US Supreme Court. Myriad Genetics and the University of Utah own several patents covering particular isolated human genes, seemingly man-made complementary DNA that mimics the natural DNA sequence, methods for obtaining the DNA, and methods for using the DNA to test for disease. The major breakthrough made by the Myriad Scientists was to discover the naturally occurring sequence of DNA that codes for early-onset breast cancer. These are the so-called BRCA1 and BRCA2 genes. This was a huge breakthrough and has been applied to save many lives. However, historic patent law is clear that the mere information discovered is not patentable. That information could be classified as both a natural phenomenon and an abstract idea—both of which lack patent eligibility. So, instead of patenting the information, the researchers applied molecular biology tools (conventional at the time) to isolate the DNA, and create cDNA. It was those structures and methods that Myriad patented, although the innovative heart of each patent claim remained the particular unpatentable genetic sequence. A group of public-minded researchers and groups challenged the patents. Arguing on their behalf is Chris Hansen of the ACLU. Myriad called patent law expert Greg Castanias for its arguments. And, acting as amicus curae, Donald Verrilli argued on behalf of the US Government.
My take is that the court is likely to find cDNA patentable because of the man-made nature of the molecule and hold that purely isolated molecules will only be patentable if their function is significantly altered because of the isolation. This result depends upon the court buying Myriad's argument that cDNA is the equivalent of recombinant DNA whose sequence is designed by the inventors. One risk of the decision for patentees is that the court appears poised to place additional weight on the obviousness analysis. Here, it is also clear that the court does not trust the USPTO to make these determinations. As Justice Kagan mentioned "the PTO seems very patent happy".
AMP's attorney Chris Hansen began his argument with the strongest possible approach – arguing that Myriad's recognition that the BRCA genes "correlate with an increased risk of breast or ovarian cancer . . . [was] made by nature . . . [and] Myriad does not deserve a patent for it." Mr. Castanias disagreed – "What Myriad inventors created in this circumstance was a new molecule that had never before been known to the world."
A first focus of the argument was on whether the isolated DNA has a new function – different from that found in the human body.
JUSTICE ALITO: Isolated DNA has a very different function from the DNA as it exists in nature. And although the chemical composition may not be different, it — it certainly is in a different form. So what is the distinction?
MR. HANSEN: Well, I don't think it has a new function, Your Honor, with respect. I believe that what — Myriad has proffered essentially three functions for the DNA outside the body as opposed to inside the body. The first is we can look at it. And that's true, but that's not really a new function. That's simply the nature of when you extract something you can look at it better.
The second two rationales that Myriad has proffered are that it can be used as probes and primers. Three of the lower court judges found that full-length DNA, which all of these patent claims include, cannot be used as probes and primers. But more important, finding a new use for a product of nature, if you don't change the product of nature, is not patentable. If I find a new way of taking gold and making earrings out of it, that doesn't entitle me to a patent on gold. If I find a new way of using lead, it doesn't entitle me to a patent on lead.
As I mentioned, everyone recognizes that Myriad made a major advance in our understanding of human genetics. The focused then turned to how Myriad should be rewarded.
JUSTICE KAGAN: Mr. Hansen, could you tell me what you think the incentives are for a company to do what Myriad did? If you assume that it takes a lot of work and takes a lot of investment to identify this gene, but the gene is not changed in composition, and what you just said is that discovering uses for that gene would not be patentable even if those new — even if those uses are new, what does Myriad get out of this deal? Why shouldn't we worry that Myriad or companies like it will just say, well, you know, we're not going to do this work anymore?
MR. HANSEN: Well, we know that would not have happened in this particular case, Your Honor. We know that there were other labs looking for the BRCA genes and they had announced that they would not patent them if they were the first to find it. We also know that prior to the patent actually being issued, there were other labs doing BRCA testing and Myriad shut all that testing down. So we know in this particular case that problem would not have arisen.
But the point of the whole — the whole point of the product of nature doctrine is that when you lock up a product of nature, it prevents industry from innovating and — and making new discoveries. That's the reason we have the product of nature doctrine, is because there may be a million things you can do with the BRCA gene, but nobody but Myriad is allowed to look at it and that is impeding science rather than advancing it.
MR. HANSEN: [Further], taxpayers paid for much of the investment in Myriad's work. I [also] think you get enormous recognition.
SCALIA: Well, that's lovely.
MR. HANSEN: But I think that we know that that's sufficient. We know it's sufficient with respect to these two genes. We also know it's sufficient with respect to the human genome.
JUSTICE KENNEDY: But I just don't think we can decide the case on the ground, oh, don't worry about investment, it'll come. I just don't think we can do that.
The patented cDNA is not found in the human body, but instead was manufactured by the researchers by using a discovered enzyme to convert mRNA created in the body back in to the more stable DNA form.
JUSTICE SOTOMAYOR: [cDNA] is artificially created in the laboratory, so it's not bound in nature. It's not taking a gene and snipping something that's in nature. And yet you claim that can't be patented. The introns are taken out, the exons are left in, and they're sequenced together. Give me your brief argument on that. I read your brief, but it is not a product of nature; it's a product of human invention.
MR. HANSEN: There are two big differences between cDNA and DNA. The first is exactly the one Your Honor just discussed, which is that the introns, the noncoding regions, have been removed. That is done in the body, by the body. That's done in the process of DNA going to mRNA. What the scientist does who's creating the cDNA is they take the mRNA out of the body and then they simply have the natural nature-driven nucleotide binding processes complement the mRNA. So that if the mRNA has a C, the scientist just puts the corresponding nucleotide in there and nature causes them to bind up. The scientist does not decide -
JUSTICE BREYER: I know, but I don't see the answer, because I gather, if I — if I've read it correctly, that when you have an R — the messenger RNA does not have the same base pairs. There's a U or something instead of an A or whatever it is.
MR. HANSEN: Yes.
JUSTICE BREYER: So when you actually look, if you could get a super-microscope and look at what they have with the cDNA, with their cDNA, you would discover something with an A, not a U. Is it AU? Is that the one?
MR. HANSEN: Yes.
JUSTICE BREYER: Okay. Okay. So — so you would discover something with an A there, you see, and you wouldn't discover something with a U there. And there is no such thing in nature as the no-introns AGG, whatever, okay? It's not there. That's not truly isolated DNA. But you can go look up the Amazon, wherever you want. Hence the question. Now, on that one, how? How is that found in nature? The answer is it isn't.
MR. HANSEN: Well, but I would suggest, Your Honor, that the question is not whether it is identical to something in nature. The question is whether there was a human invention involved, whether it is markedly different from what is found in nature.
JUSTICE SOTOMAYOR: But that goes to obviousness. That does not in my mind go to the issue of whether it's patent eligible. You may have a very strong argument on obviousness, but why does it not -it's creating something that's not found in nature at all.
. . . CHIEF JUSTICE ROBERTS: But I — I thought the basic general approach here was we have a very expansive view of what is patent eligible and then we narrow things through things — issues like obviousness and so on. Why — wouldn't it make more sense to address the questions at issue here in the obviousness realm?
. . . . JUSTICE ALITO: This case has been structured in an effort to get us to decide this on the broadest possible ground . . . it's just about 101, it's not about any other provision of the Patent Act. Why should we do that?
. . . . JUSTICE BREYER: Ah. Then — then watch what you're doing. That's very, very interesting, because, really, we are reducing, then, 101 to anything under the sun, and — and that, it seems to me, we've rejected more often than we've followed it.
As it should, the discussion eventually worked its way to the patenting of ideas.
JUSTICE SOTOMAYOR: That's a failure of the patent law. It doesn't patent ideas.
MR. HANSEN: And it shouldn't patent ideas, and — but it also makes the point that isolated gene and the gene in the body are the same.
. . .
GENERAL VERRILLI: The claim that isolated DNA is a human invention rests entirely on the fact that it is no longer connected at the molecular level to what surrounded it in the body. But allowing a patent on that basis would effectively preempt anyone else from using the gene itself for any medical or scientific purpose. That is not true about a patent on cDNA. A patent on cDNA leaves the isolated DNA available for other scientists and other — and others in the medical profession to try to generate new uses. . . . [T]he position of the United States is that [as a conceptual matter] cDNA is patent eligible.
. . .
JUSTICE KAGAN: The first person who found a chromosome and isolated it, I think we can all say that that was a very useful discovery. And the question is, can you then — can the person who found that chromosome and isolated it from the body, could they have gone to the PTO?
A decision in the case is expected in June.
STILL no answer from Malcolm on this point.
Malcolm, the point I’m trying to make here is that binary code when executed in a computer has certain functionality based upon the sequence of instructions. Yet when encoded on a disk or loaded into a memory, it also has structure, but the structure varies depending upon the media in which it is encoded. The particular structure is largely irrelevant to the functionality the instructions have because the functionality is not dictated by the structure, but by the sequence.
That is my point. That is also Sotomayer’s point. Why we talking about structure of a molecule when the structure is largely irrelevant to the functionality just as in computer code.
Dennis,
Audio of the oral arguments in this matter is available:
link to supremecourt.gov
Scott,
You are missing the point.
Isolation may be enough to evidence invention.
But it also may not be enough.
We even have Malcolm admitting this now.
Malcolm’s vacuous merry-go-round continues.
And that’s the problem.
“That’s incredibly easy to do”
Because patents are supposed to be for the ‘elite’ and sport of kings and flashes of genius…
No wait, they are not.
s-ckie :I’m fairly certain that you’re not as dense as you’re pretending to be
Keep digging, s-ckie.
The particular combination of 1’s and 0’s used to implement a step will depend on the hardware that does the processing
Right. That’s why there’s no correlation between the typical steps recited in a computer-implemented claim and 1’s and 0’s on the readable medium. That’s in complete contrast to the genetic code, which is universal and even the few exceptions are understood by those skilled in the art.
Consider a fairly common type of chemical composition claim that include a variety of “R” groups that can have any one of a variety of molecular structures. Are these claims invalid because they encompass a variety of different specific structures?
Depends on the claim and exactly what is recited. What did you have in mind? Note that even in cases where a genus of chemical moieties is recited (or “R groups”), it’s typically a group with easily recognizable structures be they elements from the periodic table (e.g., “halogens”) or other well-understood structues (“fatty acids”, “alkenes”, “metals”, etc). Examination is properly conducted on the basis of that structure, and between that and judicial review any overreaching claims are killed.
This is not the case at all with claims to computer-readable media, which are composittions that are treated as method claims for examination purposes. Of course you know that already. And you also know why that is the case. And yet you continue repeating nonsense like this:
Just as the letters used in gene patents are descriptions of molecular structures, the method steps are descriptions of digital structures.
Repeat it as often as you wish. It remains false, for the reasons I’ve explained.
“A computer-readable medium with digital information, wherein said digital information is 01010101010101010011110101010011101010111110100111”, that is clearly not patentable, for a variety of reasons (primarily indefiniteness and lack of utility).
What’s indefinite about it? How can you possibly know simply from looking at a complex sequence of binary code that it lacks utility? That’s certainly not true of a complicated DNA sequence. And yet you keep insisting they are “the same.” You are wrong.
And by the way, most people of a certain age grew up programming computers. I’m one of them. It isn’t rocket science. It’s hard work. You know what isn’t hard work, though? Describing a computer that does something that hasn’t been described before and telling other people: “now you write the code and figure out a way to sell it to people”. That’s incredibly easy to do. And that’s the problem.
I’m fairly certain that you’re not as dense as you’re pretending to be, but just in case you really don’t understand how computers work, there are in fact many digital “structures” that correspond to a typical computer-implemented method step. The particular combination of 1’s and 0’s used to implement a step will depend on the hardware that does the processing, the programming language, the implementation, etc.
Just as the letters used in gene patents are descriptions of molecular structures, the method steps are descriptions of digital structures. Consider a fairly common type of chemical composition claim that include a variety of “R” groups that can have any one of a variety of molecular structures. Are these claims invalid because they encompass a variety of different specific structures?
As for your example of “A computer-readable medium with digital information, wherein said digital information is 01010101010101010011110101010011101010111110100111”, that is clearly not patentable, for a variety of reasons (primarily indefiniteness and lack of utility). Of course, no one would file such a claim anyway because it would be incredible narrow.
You may be right about Taxol (solubility problems etc.). I am sure a search would turn up many products isolated from plants or coral etc. that have found a use and were patented.
“meaningless”
other than, by controlling law that you have admitted to, you mean…
…that patentability perspective – you know, the controlling law one.
LOL
I think that it would have been more appropriate to answer: “well.. I’m not so sure but let’s assume that it is correct”
Or maybe, “Are you trying to state the fact that RNA uses uracil instead of thymidine to a pair with adenosine? That’s correct but I’m not sure what you’re driving at. The nucleic acid composition claims at issue here, at least, do not encmpass RNA molecules.”
Ned: One can actually attach the computer code, in binary, to the patent specification and claim it — at least as a dependent claim.
This is true, Ned, but it doesn’t affect the answer to your (strange) question. Look, I kind find similarities between DNA and a zipper. So what? They are “different in kind” (horrible choice of words, by the way).
But the point you raise about attaching binary code as a dependent claim … have you ever seen that done? What does the USPTO do with the digital information? Is there a database for comparing that bindary code to the “prior art” of binary code? As you know, it’s possible for a given stretch of binary code to be used to instruct a computer to do anything. You just need to program the computer to interpret the code as you wish. As you surely are aware, this is one of the major and fundamental problems with the false (but foundational) assertion that “algorithms correspond to electronic structure”. There is no such “correspondence”, unless the word “correspondence” simply means that “some structure” exists in which case it is a meaningless correspondence from a patentability perspective.
s-ckie: How so? ACTCGACTGCGATCCACTCTACG isn’t structure, it’s just a bunch of letters.
Sure, if you’re a m-r-n completely unskilled in the art without any sense of context.
I realize that to one skilled in biological arts these letters are a convenient shorthand for describing molecular structures.
Uh … they are descriptions of molecular structures. The are required to be recited in every claim to every new nucleic acid composition. They are no more “shorthand” for structure than words describing a structure are “shorthand” for structure.
I think the point you are missing is that to one skilled in computational arts a series of method steps to be preformed by code on a disk are shorthand for the 1’s and 0’s encoded on the disk.
There’s no defined correlation between a series of 1’s and 0’s and “informing granny’s sister of a new DVD that she will like” or any other method step that could possibly form the basis of a novel method claimed as “instructions on computer-readable media”. None. Zilcho.
Consider: “A computer-readable medium with digital information, wherein said digital information is 01010101010101010011110101010011101010111110100111” is not patentable structure. You could never patent such a composition of matter. Try it. That’s not true of “A nucleic acid consisting of AGCGCGGGTAGCGCGCGAGAGATATAGAGCGG,” for the reason I set forth above. To recap, those “letters” correspond to specific structure in an unambiguous and definite manner. There is no such defined correspondance between a typical computer-implemented method step and the digital “structure” read/stored by a computer.
anon, the below was not posted yesterday:
Well anon, the programmed disc is physically different as well in that the sequence of 1’s and o’s is different.
But Sotomayor did ask this, what are we patenting when the discovery is the sequence, and the value (functionality) is in the sequence and not in the particular disc structure.
Malcolm, thanks for the response. I tried to post this yesterday, but it didn’t make it. I’ll try again.
Malcolm, I don’t think the form of the claim is that important. One can actually attach the computer code, in binary, to the patent specification and claim it — at least as a dependent claim. The “flow chart” form of claiming is simply a high level of description of the code actually on the disc.
Take a look at this sequence from the oral argument for more explanation of the question:
“JUSTICE SOTOMAYOR: I — I have a sort of analytical problem. I find it very, very difficult to conceive how you can patent a sequential numbering system by nature, in the same way that I have a problem in thinking that someone could get a patent on the computer binary code merely because they throw a certain number of things on a piece of paper in a certain order.
I always thought that to have a patent you had to take something and add to what nature does. So how do you add to nature when all you are doing is copying its sequence?
MR. CASTANIAS: Well, I guess I’ll -JUSTICE
SOTOMAYOR: How do you add to it besides process or use?”
I don’t think that is a silly question at all.
“claims to nucleic acids are described in ways that distinguish them structurally from other nucleic acids.”
How so? ACTCGACTGCGATCCACTCTACG isn’t structure, it’s just a bunch of letters.
I realize that to one skilled in biological arts these letters are a convenient shorthand for describing molecular structures. I think the point you are missing is that to one skilled in computational arts a series of method steps to be preformed by code on a disk are shorthand for the 1’s and 0’s encoded on the disk.
(That said, claims in the computer arts which just functionally recite a desired result rather than the steps for achieving that result should be DOA at the USPTO as well.)
“JUSTICE BREYER: I know, but I don’t see the answer, because I gather, if I — if I’ve read it correctly, that when you have an R — the messenger RNA does not have the same base pairs. There’s a U or something instead of an A or whatever it is.
MR. HANSEN: Yes.
JUSTICE BREYER: So when you actually look, if you could get a super-microscope and look at what they have with the cDNA, with their cDNA, you would discover something with an A, not a U. Is it AU? Is that the one?
MR. HANSEN: Yes.”
I think that it would have been more appropriate to answer: “well.. I’m not so sure but let’s assume that it is correct”
“Please, be real here. You DNA guys are dancing as much as the information processing guys in computers to try to get people not to see the real invention.”
An interesting statement coming from NWPA.
Though at least they do us the favor of spilling out the long-arse “code” for their gene and limiting their claims to that.
That will depend on the construction of whatever claim you write to draft them. However, you can certainly draft a claim to either of them that is more preemptive than a claim you can make to the other.
If you intend for them both to be claims right now, and giving the former a broad construction, then it is more preemptive. If you give the former a narrow construction then they are non-overlapping.
Glaringly absent from Malcolm’s response is the current state of controlling law.
Ned: How is DNA any different in kind from a disc encoding a program who utility is in the information?
This is pretty much the silliest question I’ve ever heard. How is deoxyribonucleic acid different in kind from a computer disc?
You seem to have forgotten something rather important that has been explained to you several times already, by myself and others: claims to nucleic acids are described in ways that distinguish them structurally from other nucleic acids. That’s not the way “computer discs” are claimed, ever (at least not the “computer disc” claims that you are referring to).
DNA is a chemical composition of matter (or article of manufacture if you prefer) and for that reason the rules which apply to composition claims apply to DNA: they can’t be claimed purely based on the recitation of a new function (“1. DNA encoding a protein that does this awesome thing that people would like it to do.” <-- dead on arrival at the PTO). In that regard, computer discs are probably the least similar compositions to DNA on earth, at least from the USPTO's perspective. I don't even know if this is responsive to the point you were making, Ned. But I tried.
So if you accept the premise that the decision has been made, the proposition is not circular.
Um … okay. What “decision” are you referring to?
I read your comment five times and I’m finding it rather obtuse. Are you making an argument in defense of a test to determine patent eligibility of certain types of method claims (i.e., claims in form [oldstep]+[newthought], such as those in Prometheus)?
If so, what is the test?
I think it’s an incredibly easy argument to make persuasively that a new information-processing method lacks substantial utility if it is performed entirely in the mind.
Okay. What’s the argument?
Consider in your answer the claims in Prometheus, which are not entirely performed in the mind and which, if practiced, arguably prevent a doctor (an ethical one, anway) from administering injury-causing drugs to a patient.
it is therefore not patent-eligible. In such a case, my statement above is true, because there is literally no way any substantial utility could be asserted.
Do you think laws of nature lack substantial utility? Lack of utility is just one way of determining that something is not patent eligible under 101. It’s not the only way. The universe of ineligible subject matter is larger than the universe of subject matter lacking substantial utility. At least, I’ve never heard anyone suggest otherwise. Maybe until now? Let me know.
Has taxol ever been patented? I’m guessing that compositionally, only derivatives of taxol or a mixture containing taxol and other agents have been granted patents.
“Malcolm has often asked, but no one has answered, clearly, whether the later discovery of a composition in nature will invalidate a patent on a novel composition.”
WRONG
I have clearly and repeatedly answered this.
So has the Supreme Court. See Chakrabarty.
Stop looking at 102. See Prometheus.
Please stop the intellectual dishonesty Ned.
“The real problem comes with infringement”
Now here – this, this is the very thing that sends Malcolm running away at light speed. The very very very simple question he refuses to answer.
What are the odds that he will ever answer?
(in an intellectually honest manner, that is)
“The disc is the same”
Most definitely not.
And we all know how it is different – in the important FUNCTIONALLY RELATED way. (I can see a variation of the famous Grand Hall experiment in my mind…)
Thus, Malcolm’s self admitted knowledge of the controlling law regarding the exception to the printed matter doctrine DOOM his agenda.
Funny that Ned has never even acknowledged this aspect of law.
Wait, no it is not. It is directly related to his third party interest influenced nature of posting on the blog, in clear violation of blog rules about posts being of a personal nature. It’s pretty D_@MM lame.
C’est la vie.
Malcolm has often asked, but no one has answered, clearly, whether the later discovery of a composition in nature will invalidate a patent on a novel composition.
May I add to Malcolm’s question one more variant, that the claimed novel composition is not extracted, isolated or culled in any form any naturally existing form, but instead is engineered out of base components, and without reference to any known or discovered naturally occurring forms.
In no sense then is the naturally occurring compound 102(f) prior art. Nor is it properly 102(a) or (b) prior use or knowledge, not being known or in use. It simply existed before, unknown.
I think the patent valid. The real problem comes with infringement. Is it infringement to take from the plant the composition made by the plant? And if not, is it then infringement to use it or to sell it?
If you can take a plant and isolate a compound and find a use for it and get a patent (think Taxol and cancer treatment), what is the difference then in isolating a gene from a person and finding a use for it? The only difference is the source of the compound. If you ban gene patenting then you have to ban compound patenting if isolated from nature.
MM, I think the good man, austinap, may have a point on “information.” How often here have we discussed the difference between a disc encoded with one program vis-a-vis a different program. The disc is the same, and only the information distinct.
With DNA, the chemical formulas of particular location are one of four. A sequence is comprised of varying these four. A sequence has utility because of the “information” encoded in the sequence. How is DNA any different in kind from a disc encoding a program who utility is in the information?
Now you may noted the chemical claimed (isolated DNA) is unique. But its structure is dictated by information, and that information is in the discovered DNA.
Even pre-emptively not responding to me doesn’t save you from yourself, Malcolm.
This thread too is archived.
The Gloatfest-Over-Malcolm continues.
The sideshow is indeed complete. See below.
(it’s just not the sideshow Malcolm purports – gee, is anyone surprised?)
“He chooses simply to never invoke the doctrine?”
LOL – sorry 6, he so chose today. See below.
“belongs to “nature’s warehouse” and the mere recitation of “isolated” isn’t enough to get you off the hook.”
LOL
The mad dancing is complete – Malcolm has come to my stated view.
Not bad for someone with English as a first language. He must have somehow understand what has been said all along for him to trot it out and make it his own when talking to a fellow PhD.
So “computer binary code merely” that writes better briefs than Soot-in-my-ear could? Such ignorance.
Obama is a disaster. He doesn’t understand science and has no respect to put this lot in the SCOTUS.
Let’s say for argument sake that I patented a peptide sequence that is 30 aa long only to find out that sequence is part of a longer protein (different protein) discovered in insects. Why should my peptide sequence be patent ineligible if my peptide has (let’s say) an alpha helical structure while the same sequence is an unstructured loop as part of the longer sequence.
Good question. As devil’s advocate I might say that the insect protein is surely degraded in each cell in which it is expressed so statistically, then, the protein you described belongs to “nature’s warehouse” and the mere recitation of “isolated” isn’t enough to get you off the hook. Or I might argue “pre-emption” along similar lines: resarchers can’t fractionate the insect cells without infringing your claim. To be clear, I don’t think those arguments should be determinative but that doesn’t mean they won’t “win” at the Supreme Court. Certainly those arguments are not distinguishable from the arguments that are being tossed about by some of the Justices and the ACLU (“merely determining where to cut”, “snipping”, etc).
I think we’re pretty much in agreement about everything else although I still don’t agree with your nomenclature. I also don’t want to quibble about it anymore. Suffice it to say that polymers in solution that are not “folded” still have determinable 3-D structures, at least statistically determinable ones, and in certain contexts those statistically determinable structures are just as “real” and useful to scientists as a the structure of a polymer that has been crystallized under phsyiologically irrelevant salt concentrations. I’m sure you know this already. 😉
Sorry for being inconsistent with my terminology. When I say 3-D, I mean folded structure. As a structural biologist, we would say that a biopolymer that is not folded only has a primary structure and does not have a 3-D structure. By this I mean, in solution a strand of unstructured biopolymer would fluctuate so much that we could only get an average view of what that may look like. It does not have at least a single lowest energy global 3-D structure in solution.
The folded structure is also distinct from tertiary structure. To me tertiary structure could be the interaction between a hairpin loop that is several hundred bases away from a second hairpin loop. THAT interaction is tertiary but is different from the folded structure (3-D structure). The function of DNA as a medium of genetic information does not depend on the particular folded structure- it depends on the primary sequence.
This is not the case with enzymes (protein enzymes and RNA enzymes). There is an intimate connection between the folded structure and the function of the enzymes. Even if the enzyme has the correct primary sequence, it cannot function (has no utility) if it is not folded correctly. For me this raises several issues.
Is a shorter biopolymer sequence anticipated by a longer biopolymer sequence containing the shorter sequence if the shorter sequence has a different folded structure that the SAME sequence in the longer biopolymer sequence? Let’s say for argument sake that I patented a peptide sequence that is 30 aa long only to find out that sequence is part of a longer protein (different protein) discovered in insects. Why should my peptide sequence be patent ineligible if my peptide has (let’s say) an alpha helical structure while the same sequence is an unstructured loop as part of the longer sequence. It’s obvious that a shorter biopolymer sequence may have a utility that is not present in the longer sequence (not always the case). Perfect example is a primer. A good primer sequence can bind more specifically than a longer DNA sequence.
My point is that it may be incorrect to determine that a biopolymer sequence is patent ineligible by merely looking at its primary sequence. It may be better to determine patent eligibility by looking at the utility question more critically- perhaps more stringently.
MP
Mike, I’ve got a Ph.D. biochemistry as well. I’m very familiar with nucleic acid structure. As they say, “I was there” for all the major developments in the post-Boyer era, met all the major players in RNA structure, etc. I understand the science and the technology. I’m taking issue with your distinctions because they gloss over scientific facts in way that is unhelpful.
My point with DNA is that its 3-D structure does not determine its function wrt storing genetic information (that’s in its primary sequence).
Please stop saying “3-D structure” when you mean tertiary structure. 3-D means 3-D, i.e., 3-dimensional. DNA molecules are 3-dimensional. If you mean primary structure, which is shorthand for “sequence”, then say primary structure.
In any event, I’m still having difficulty following your argument. The primary structure, second structure and tertiary structure of all these molecules (DNA, RNA, protein) depends on many factors and all these structures affect the “function” of the molecule. “Function”, of course, is an abstraction that is imposed by humans on these molecules, particularly when it comes to functions like “storing” “information.” Amino acid polymers arguably “store” “information” about the RNA or DNA sequences which “encode” them. So what?
a fundamental utility question when you isolate and cut out biopolymers since 3-D structure often determines a molecules function.
Again, since the structure of a polymer dictates its function, changing the structure will change the function, depending on how you assay that function, and that includes changing the primary structure. This is true for all biomolecules, including DNA.
RNA has many other function like catalysis during splicing to get rid of introns.
I get that. DNA has non-protein coding “functions” like adopting secondary structures that are acted upon by chromosomal replication enzymes and transcription enzymes and proteins involved in packaging and translocation of chromosomes in replicating cells. My point again is this: it’s a bad idea to make a subject-matter eligibility test for novel non-obvious biopolymers based on the distinctions you are making. A much better idea is to simply ask whether the applicant has demonstrated a specific substantial and credibility for the polymer, one that applies to DNA polymers, RNA polymers, and amino acid polymers and any other molecule. In that regard, I am not necessarily opposed to the ineligibility of claims to novel, non-obvious nucleic polymers with no other function than to recognize its complement (for diagnostic purposes, either as a probe or a primer) or be used as an object for further research.
As I noted upthread, what’s strange is that the ACLU seemed to admit that the former utility would be enough for eligiblity (!), and that they didn’t even bother to challenge the ineligibility of methods that were little more than research plans to study the expression of a cDNA of unknown function!
Hi MM,
I think you may be misunderstanding where I am coming. I’m not sure what you’re technical background is in but I received a PhD in RNA chemistry. When I say overall 3-D structure, it is distinct from tertiary interactions and also distinct from primary sequence (including the hydrogen bonding that the bases can provide). There is a fundamental difference between biopolymers and small molecules because biopolymers need to fold in solution in order to obtain their 3-D globular structure. A biopolymer is inherently 3-D but we RNA chemists view 3-D structure as the folded structure. In this way, I am merely stating that the genetic information is stored in the primary sequence (in the sequence of bases) and has nothing to do with how those sequences are folded together to form a 3-D structure. This is not the same with proteins and in some cases RNA.
To answer your question, I believe RNA polymerase recognizes the primary sequence of the DNA when it binds and starts the transcription process. The reason why I make a distinction between the different levels of structure is because biopolymers can be structurally altered (in its tertiary and secondary structures) if they are snipped out of a longer sequence. So that raises a fundamental utility question when you isolate and cut out biopolymers since 3-D structure often determines a molecules function. My point with DNA is that its 3-D structure does not determine its function wrt storing genetic information (that’s in its primary sequence). Same is true for RNA when it is used to store genetic information. But RNA has many other function like catalysis during splicing to get rid of introns.
Mooney, these things do not reflect any underlying physical reality, they are decisions that are made by society.
So, it’s not circular, because the starting-point of the inquiry is wherever the initial decision lies.
For instance, take my statement that you italicized. Now think about Prometheus, or any claim in your “old steps/new thought” paradigm. There are certain things on which it must at some point be decided that society is in agreement to the extent that a rule can be stated–for instance, that merely thinking about something does not impart to an otherwise old process a quality that renders it worthy of patent protection.
In other words, we decide that it isn’t patent-eligible, the first part of my statement.
Use a physics trick, and take this to the extreme: imagine a method claim that recites nothing but thinking about something. Nobody whose opinion matters would currently suggest that such a claim was worthy of patent protection, and it is therefore not patent-eligible. In such a case, my statement above is true, because there is literally no way any substantial utility could be asserted.
Now, I don’t know that my statement has any effect beyond the “thinking” types of claims–but it might. And even if it doesn’t, it is an elegant way to articulate under the law why those claims are not patent-eligible.
Conversely, anything for which a substantial utility CAN be asserted will be patent-eligible, but since 101 utility dovetails with 112 how to use, the scope of any granted patent will be delimited by that combination of 101/112, and that scope will be reflected in how the claims are actually drafted.
So if you accept the premise that the decision has been made, the proposition is not circular.
I’m not sure I understand you correctly, but I think it’s an incredibly easy argument to make persuasively that a new information-processing method lacks substantial utility if it is performed entirely in the mind.
Maybe it is because we are talking with different understandings of “substantiality”. I think I have posted mine here somewhere before, I will try to find and link to it. It’s not entirely whole cloth, IIRC! And IIRC it is easy to buy into, for a court.
NWPA said: “Why are people going to make these discoveries without any incentive?”
I say: Beats me – without the incentive of patents, technological innovation cannot occur. Scientists will have no desire to discover and invent new stuff without patents. It’s mind boggling that people do not understand this simple concept. Consider the ancient Romans and Greeks, they did not have patents, so they never came up with anything. Unbelievable.
In other words, the 3-D structure (and tertiary structure for that matter) does not affect what protein a particular gene encodes only the primary structure (i.e., sequence).
Mike, the claims we are talking about are directed to a 3-D structure. What aspect of DNA do you think RNA polymerase recognizes? Do you think it reads a book about the DNA sequence so it knows where to land? C’mon.
DNA’s main utility (storing genetic information) is not tied to its 3-D global structure.
Certainly not true in humans.
link to en.wikipedia.org
And you could easily argue that RNA’s “main utility” is to store genetic information for translation by ribosomes. I’m still not buying the distinction you are making. To be clear, I’m not arguing that these molecules (DNA, RNA, protein) have the same function. I’m pointing out that a legal test which determines eligibility of a biopolymer solely based on whether the sequence of the biopolymer is comprised by a larger “naturally occurring” biopolymer is a very very bad test. But such a test certainly appears to be on the table, at least.
To the extent it’s not on the table, we are looking at a pure utility test in which the similarity between the claimed sequence and a longer, previously undisclosed sequence “found in nature” is not relevant. Either the compostion of matter has a specific, substantial and credible utility or it doesnt. For example, a novel non-obvious cDNA with no known function (other than encoding an RNA or protein for further study) would remain ineligible under 101, just as expressed sequence tags were deemed ineligible under 101 many years ago.
6: As I understand it, the probes and primers are a subset of the more broadly claimed other claims. In which case, it is impossible for them to be more preemptive.
Which claim is more “pre-emptive”?
A. A drop of water.
B. A circular lake filled with water.
Nothing controversial about most of what you say, IBP. I think we’re in general agreement. I might quibble with an aspect of this:
for things that aren’t patent-eligible, no substantial utility will be able to be asserted.
Seems like there is some circularity here, no? Are you referring to the judicial exceptions? I think this is where we parted ways somewhat with the Prometheus claims. I think it’s a difficult argument to make persuasively that a new information-processing method lacks substantial utility simply because, e.g., it’s performed in the mind. I’m certainly not suggesting that such processes are eligible … just not sure about using 101 utility to get there.
Discovery? No (the patent jurisprudence is pretty clear on that)
Purification? Maybe (this still hinges on whether or not a change in kind has been effected.
Information? No (sorry, but information only is not enough – to paraphrase Prometheus, you need something more)
I think that the gene should be patent eligible. After all, it really isn’t any different than discovering some new chemical in the natural world in a plant for example and then extracting it.
So, I think there are two good arguments for eligibility. Discovery and purification and information.
It is an interesting comment actually.
But, in reality, here you are saying they aren’t claiming the information—the correlation between a gene and cancer–but a method of detecting that gene. But, the method was well known. Extraction, probes, etc. All of that was well known.
Isn’t it a fact that the only invention here is the discovery of the gene and relationship to cancer? I don’t see this as any different than Prometheus. It is just in Prometheus the level of [insert chemical] in the human body could be done in a routine blood test. Here, one has to do some fancy extraction and testing, but fancy testing that was well, well, known in the art. It could be said as well known as the blood test for the level of [insert chemical].
Above, that is the reality of the situation. All the rest is just bundles of nonsense.
Now, I haven’t read all the claims, but would one read on determining the structure of the gene using microscopy? What about a new method that has not been invented to discovery the structure of the gene?
Please, be real here. You DNA guys are dancing as much as the information processing guys in computers to try to get people not to see the real invention.
Utility: information: a prediction. Discovery: a relationship between a gene and cancer. Nothing else there. Everything else was well known.
It is true that now the gene has been discovered that perhaps more tests can be performed to gain a greater understanding of the gene. And, there is no doubt massive utility to having to be able to isolate a portion of the DNA that is a gene for further testing and experiments.
LOL.
He chooses simply to never invoke the doctrine?
Um, sure, did he patent those godly powers in his alternative universe?
LOL – like he has a choice?
C’mon 6, ignoring the valid points made is simply no answer.
No answer at all.
None.
And none of his long winded, dust-kicking vacuous posts contain ANY answers.
And they never have.
So I have take your answer as ‘6 is just clueless.’
I can deal with that.
Ok, but just so we’re clear then, you are predicting that specifically whether the change is enough to make a change in kind will be implicated directly in the opinion although that will not necessarily be the sole or main grounds for their opinion. Although you are open to other issues also being mentioned, or perhaps being the entire premise of the actual decision.
As to your question about MM, I’m sorry I don’t understand what you were saying in your question. Although I think, if I had to guess at what you meant, that he has replied, on a number of occasions and his view is very long and I will not repeat it here for you in total. However, on the whole, he is not a fan of the product of nature/natural phenom/abstract idea judicial exception doctrine(s) and would seemingly prefer them to not be applied. Thus, he would “differentiate” by simply never invoking the doctrine under which the warehouse of nature becomes relevant. And I’m not sure why you really really really need him to spell this out for you. He has made it quite clear on a number of occasions it seems to me.
I have to say though on the whole that Mr. Castinias’s little oral arg was pretty illuminating on a number of things. I really do wish that the Justices had grilled him a bit in re his assertions on preemption.
No I mean the overall 3-D structure as opposed to tertiary structure (or interaction). I don’t think the tertiary structure of DNA is all that important wrt the utility that we are talking about (namely DNA as compositions that store genetic information). In other words, the 3-D structure (and tertiary structure for that matter) does not affect what protein a particular gene encodes only the primary structure (i.e., sequence).
In this way, DNA’s main utility (storing genetic information) is not tied to its 3-D global structure. This usually does not apply to proteins and to some extent RNA (RNAs can store genetic information but they can also catalyze reactions). In that way proteins and RNA are more like traditional small molecules in that their function is closely tied to its 3-D structure and its 3-D structure can vary depending on the global primary structure. In other words, if you take a small fragment of RNA from a longer fragment and superimpose the 3-D structure of the smaller fragment onto the 3-D structure of the longer fragment, it may or may NOT overlap. Same with proteins. This is typically not the case for DNA since it is typically patented as a double strand rather than a single strand (as in proteins and RNA).
“I mean, honestly, I think that Section 103 does this work better than Section 101,”
I mean, your honor, I really think that inserting a red herring right abouts of now would really be the thing for me to do. Ifn your honor doesn’t mind.
This guy argues like so many lawltar ds, I mean seriously guys, get your sht together and put the little birds away.
“I — I think — I think, Justice Kagan, you’re really putting your finger on the problem with this, again, I — I keep wanting to refer to as the so-called Product of Nature Doctrine because I don’t believe that as a separate doctrine it really exists. It’s just the flip side of the coin of something that shows a lack of invention.”
I find his lack of faith disturbing.
As I’m sure the USSC does.
“And then what the — what the Myriad inventors then did to create what is called SEQ ID number 2 and what is claimed in claim 1 of the ‘282 patent is to take — actually manipulate that further to add in the introns. It was in — actually, the inventive process was additive.”
Yeah that’s true, it does sound like you had an inventive process on your hands there, perhaps you should have patented that rather than the result of that process.
Mike Following this logic, any DNA (whether it’s from humans or any other organism) with the same sequence as the cDNA should render the cDNA patent ineligible.
Right, which is what I’m saying: whether you call the polynucleotide “cDNA” or “hDNA” or “pDNA” or anything else is beside the point.
The question for eligibility is to first simply ask if the sequence exists anywhere “in nature” or in the prior art. If the only function of such a sequence is as a research tool for further study, then it’s ineligible. But if it has a substantial function (e.g., as a probe or a primer for diagnosing disease) then it is eligible for patenting (at least, that was the ACLU’s admission and appears to be the position of at least two Justices).
Wrt to your examples of peptides and RNA, I think DNA is a completely different beast (esp in the context of genes) because the 3-D structure of DNA is not terribly important.
You mean the tertiary structure. The 3-D structure of DNA is just as important for its function in vivo as the 3-D structure of any other molecule. That said, changing one base in the primary structure of DNA can be the difference between life and death so I don’t buy your argument at all. I don’t think you do either, frankly. It’s not wise to make sweeping legal rules about complicated chemicals based on how they “usually” behave. Many of the most interesting advances in bioscience/technology relate to molecules that behave unusually with respect to how the genus to which they belong was previously known to behave (e.g., ribozymes, deoxyribozymes, siRNAs, etc).
“When you look at those particular sequences, there was invention in the decision of where to begin the gene and where to end the gene.”
His very best argument is that there was invention in an abstract idea (aka the “decision”).
Yeah, that’s totally going to work.
“I find it very, very difficult to conceive how you can patent a sequential numbering system by nature, in the same way that I have a problem in thinking that someone could get a patent on the computer binary code merely because they throw a certain number of things on a piece of paper in a certain order.”
The learned Justice Sotomayor speaketh the truth.
fix italics
The reason I wouldn’t be worried about the poor guy in your hypothethical is because that isn’t how DNA works.
That’s a utility argument, and a rather extreme one that has not been put forth by any party to any of these proceedings that I am aware of. You’re suggesting that without a promoter (and maybe a replication origin or sequences for recombinant insertion into a chromosome?) the polynucleotide lacks substantial utility.
Does your argument also apply to a polynucleotide encoding a protein that I designed from scratch? Do you consider it to be lacking utility unless I include a promoter? If not, explain why not.
The standard response to your argument is that an isolated polynucleotide sequence encoding a protein with a known function is extremely useful for making vectors and recombinant organisms. Is that a non-substantial utility in your view? Again, that would represent a radical departure from current practice.
I think the reason most scientists are fundamentally against patents on genes (and cDNA) is because essentially they are patents on information.
Huh? Most scientists I know aren’t “fundamentally opposed” to patents on novel, non-obvious and useful protein or mRNA encoding polynucletoides. I’m a scientist and I’m not opposed. Bunch of scientists over at PatentDocs aren’t opposed. Is there some survey you’re referring to? Exactly what question was asked in that survey?
“Consider that this would have no effect on the scope of the patent of any article, composition, manufacture, or process, that was amenable to such an assertion of substantial utility.”
Is this wishful thinking? Based on law (which section)?
I have not precluded other issues, 6.
I have spoken on this particular subject.
Do you think that Malcolm will also play along? Can you get him to answer the long, long, long asked question as to how he would differentiate (if allowed to patent) something from the warehouse of nature, free to all men with his patented item?
It’s a really simple question that has always made him run and hide.
Let’s consider that your claim is to the chemical compound known as human chromosome 12.
Keeping in mind that utility must be SS&C, the question becomes how a utility should be asserted such that it will satisfy 101.
It is at once apparent that a wide range of assertions of utility is possible, all the way from something like “preventing cancer”, to something like describing the chemical action of the compound in the presence of another compound that is a known carcinogen.
There are sliding scales of SS&C, in particular in this instance of specificity and credibility, and they are intimately and inextricably connected with WD satisfaction of the “how to use” requirement of 112.
The narrower and closer to the physicality of the actual compound is the asserted utility, the less WD there needs to be to satisfy the “how to use” 112 requirement, and vice-versa, with respect to specificity and credibility.
If utility was asserted as “detecting carcinogens in drinking water”, in order for it to satisfy 101, the 112 “how to use” requirement would need to be successfully directed to said asserted utility, with respect to specificity and credibility.
If it is, fine.
If it is not, 101 fail for lack of specificity, credibility, or both.
Consider, though, substantiality. Since there is a wide variety of options in how to assert utility in a situation like this, and since some of them will be substantial and other will not, my preference would be to require that a substantial one be asserted, because therein lies the tie to patent-eligibility of subject-matter under 101. Only assertions of substantial utility should suffice.
Consider that this would have no effect on the scope of the patent of any article, composition, manufacture, or process, that was amenable to such an assertion of substantial utility. So, for things that are actually patent-eligible, no problem exists as long as care is paid to the drafting process–which is what we are paid to do.
However, for things that aren’t patent-eligible, no substantial utility will be able to be asserted.
Substantiality of utility can therefore act as just the type of bright-line filter that everybody is looking for in 101, as long as applications are well-drafted.
It isn’t a “poison test” MM.
“Let’s call it a “chemical that interferes with utility.” What’s the distinction?”
That will depend on the “chemical that interferes with utility”.
“in spite of the fact that the so-called “pre-emptive” effect of the probe claims is arguably even greater than that of the longer claims. ”
Hmmm, I’m doubting this is the case, likely because the “argument” that “could be made” or whatever isn’t a good argument because the person who is about to make it doesn’t understand the preemption doctrine at all.
As I understand it, the probes and primers are a subset of the more broadly claimed other claims. In which case, it is impossible for them to be more preemptive.
Alrighty, so no preemption in there at all? Just so that we have our bets all closely defined.
“However, without access to cDNA, essentially all gene cloning applications are barred”
I take it that you’re talking about the “recombinant” gene work they were talking about in the oral args. I’m going to be honest with you, while there is Flook which puts a prohibition on “field of use” limitations saving a claim from 101, other than that what you’re talking about simply isn’t a problem 🙁
“n biochemical terms, cDNA vs. “gene” is a distinction without a practical difference.”
If it be so then they may go down with the other claims. I’m simply too ignorant on the biochem to say definitively. However, I will tell you that the supremes likely will be as well, and thus will likely leave them undisturbed.
IBP,
You forget that different rules apply to the backyard of Malcolm.
It all depends on whether the change is enough to make a change in kind.
The warehouse of nature must be maintained free to all men.
.
wax on, tags OFF. Maybe.
“But more important, finding a new use for a product of nature, if you don’t change the product of nature, is not patentable. ”
When did this happen?
Forgot to close my italics
“let’s say I discover a microbial organism in the stomach of a blind grasshopper that lives in a cave in Madagascar. Before any disclosure, I further isolate a cDNA from that microbe and show that when it is injected into human hair follicle cells it causes hair to grow magnificently thick and fast. What would the policy rationale be for denying me a patent on the previously non-existing isolated DNA sequence encoding that protein (and nothing else), whether it’s a “cDNA” or a native DNA sequence?”
The reason I wouldn’t be worried about the poor guy in your hypothethical is because that isn’t how DNA works. If you’re really just talking about gene therapy, then patent the construct that you would use to deliver that gene. In your hypothetical world, I actually wouldn’t have a problem with granting him a patent on using the cDNA for that purpose.
I think the reason most scientists are fundamentally against patents on genes (and cDNA) is because essentially they are patents on information. We rarely care about the physical molecules except for when we need to extract information from them in some way – whether that is reading the sequence, producing the protein for which they code, looking at how variations correlate with diseases, etc. Even in Myriad’s claim they’re simply just want control over the information, a patent on the physical cDNA is just a means of doing that.
Upthread I asked about Formstein (Germany) and Gillette (England) and so it is good to see the self-same doctrine in the USA caselaw, in that MM writes:
“…there’s case law to the effect that the DoE can’t be used to capture the prior art or obvious differences between the claim and the prior art (i.e., equivalents which “could have been claimed” by the patentee).”
Some things just come down to universal commonsense.
DC If we have a situation where the mRNA molecules of the gene exist with introns removed, should you be able to patent the cDNA of the gene that you created simply by using reverse transcriptase on the mRNA?
I agree with Hoffman. It depends on the facts and the claims and it should typically be addressed under 102/103.
Just to ask the obvious question: let’s say I discover a microbial organism in the stomach of a blind grasshopper that lives in a cave in Madagascar. Before any disclosure, I further isolate a cDNA from that microbe and show that when it is injected into human hair follicle cells it causes hair to grow magnificently thick and fast. What would the policy rationale be for denying me a patent on the previously non-existing isolated DNA sequence encoding that protein (and nothing else), whether it’s a “cDNA” or a native DNA sequence?
By the way, in all this talk about “cDNA”, we’re not even addressing the redundancy of the code. It’s not the original cDNA sequence that matters to applicants. It’s the sequence of any DNA that encodes a protein with the same sequence as the protein encoded by the mRNA.
MM, agreed. The isolated DNA in this case is manmade and is not known. It is eligible and not obvious.
I think the attention is on cDNA because most organisms do not have the capability of producing cDNA on its own and in most cases will not possess a cDNA version of a particular gene. This seems to me a plausible way of reading our 101 statute. Following this logic, any DNA (whether it’s from humans or any other organism) with the same sequence as the cDNA should render the cDNA patent ineligible.
Wrt to your examples of peptides and RNA, I think DNA is a completely different beast (esp in the context of genes) because the 3-D structure of DNA is not terribly important. That is not the case of proteins and RNA. If you take a longer protein or RNA strand and cut it up, the 3-D structure of the protein and/or RNA can be radically different (e.g., RNA bases which were involved in tertiary interaction may be involved in hairpin formation or amino acids previously forming an alpha helix will have a random structure now). These changes in “structure” can have a fundamental influence on the utility of the protein or RNA. This is usually not the case for DNA.
Whether or not cDNA mimics “the natural DNA sequence” (whatever that is supposed to mean) depends on the context. If you’re looking for a stable genetic material from which you can produce proteins, then yes, cDNA mimics the genomic DNA.
Ahh, I apologize, I see what you’re asking now. You’re correct, HIV reverse transcriptase does have some specificity for HIV genes. Exactly how specific it is for viral RNA vs. host mRNA I am unsure.
Reread what I wrote, ‘austinap’:
Dennis said the cDNA mimics “the natural DNA sequence.” I disagreed.
The argument that a cDNA mimics the corresponding mRNA is much stronger, but that’s not what Dennis wrote.
Dennis- the solicitor general’s stance is that the cDNA should be patentable since a human typically does not have the necessary enzymes (e.g., reverse transcriptase) in order to create the cDNA from the mRNA. Thus, the cDNA does not naturally exist in nature. Obviously, AMP believes cDNA should not be patentable but Hansen was on record during the oral proceedings that limiting patents to just cDNA would be huge step forward. That’s debatable.
What is being claimed is a routine variation on something old.
Then it would be obvious.
What if it’s not a “routine variation”? Surely you aren’t suggesting that a non-obvious and useful chemical isn’t patentable or becomes ineligible just because I used routine steps to make it! Might as well just pull the plug on all article of manufacture claims if that’s your angle.
Oops sorry I don’t think my comments are scientifically sound wrt to viral cDNA being incorporated into host DNA. Based on my limited understanding of transcription enzymes, I would think that reverse transcriptase would not work on a lot of host mRNA because the reverse transcriptase probably needs to recognize a certain sequence in order bind to the mRNA and start reverse transcribing. This sequence is native in the virus RNA genome but probably does not occur too many places in the host. Thus, my basic point is the same that the number of host genes reverse transcribed by a retrovirus is probably limited to select genes.
Sorry for the redundant comment, Dennis — I read through the rest of your post and see that you do understand the distinction.
As for your question, I have to say ‘it depends’. If you’re trying to patent the cDNA for a housekeeping gene (one routinely expressed at high levels), there’s likely a pretty good argument that such a claim is obvious in view of the art (under at least a couple of the rationales set forth in MPEP 2143). But if you’re trying to patent a rare transcript (say a conditionally expressed splice variant only expressed in a particular tissue type under very particular metabolic conditions that are not fully understood), there’s probably a pretty good argument that such a claim would not be obvious, for reasons of predictability and reasonable expectation of success, at a minimum.
Either way, I’d contend that the most appropriate way to deal with such subject matter is under sections 102/103/112, not section 101.
If the sequence of a particular cDNA exists elsewhere in nature, the cDNA would presumably become patent-ineligible subject matter.
Okay … so why all the attention on cDNA, as if it’s something special? It’s not. Either the sequence of the DNA is identical to some sequence found “in nature” (whether that sequence includes additional DNA at either end or not … or any other modifications??), in which case it’s ineligible, or it’s not found “in nature”, in which case it’s eligible. And why all the focus on “human genes” when every living organism uses DNA as its genetic material?
Again, if the “logic” isn’t cabined then we run into problems really quickly. What about novel non-obvious useful peptides that are later found as part of larger protein molecules in some organism? Or novel non-obvious useful interfering RNA molecules whose sequences are not “markedly different” from a longer RNA? What if it’s not clear that the longer RNA is even expressed? Is it enough to prove ineligibility for some expert to testify that it’s likely that even without a promoter the RNA will be expressed at some incredibly low level (once out of every millionth transcription in one out of a billion cells)? It gets crazy real quick.
Well, that is essentially the entire question here, isn’t it? The mRNA of all of these cDNA sequences exists in nature. There are a few billion copies of the BRCA1 mRNA in your cells right now.