AMP v. Myriad Gene Patenting Oral Arguments

By Dennis Crouch

Association for Molecular Pathology v. Myriad Genetics, 12-398 (Supreme Court 2013) oral argument transcript.

The Supreme Court held oral arguments today in the much watched Gene patent case pending before the US Supreme Court. Myriad Genetics and the University of Utah own several patents covering particular isolated human genes, seemingly man-made complementary DNA that mimics the natural DNA sequence, methods for obtaining the DNA, and methods for using the DNA to test for disease. The major breakthrough made by the Myriad Scientists was to discover the naturally occurring sequence of DNA that codes for early-onset breast cancer. These are the so-called BRCA1 and BRCA2 genes. This was a huge breakthrough and has been applied to save many lives. However, historic patent law is clear that the mere information discovered is not patentable. That information could be classified as both a natural phenomenon and an abstract idea—both of which lack patent eligibility. So, instead of patenting the information, the researchers applied molecular biology tools (conventional at the time) to isolate the DNA, and create cDNA. It was those structures and methods that Myriad patented, although the innovative heart of each patent claim remained the particular unpatentable genetic sequence. A group of public-minded researchers and groups challenged the patents. Arguing on their behalf is Chris Hansen of the ACLU. Myriad called patent law expert Greg Castanias for its arguments. And, acting as amicus curae, Donald Verrilli argued on behalf of the US Government.

My take is that the court is likely to find cDNA patentable because of the man-made nature of the molecule and hold that purely isolated molecules will only be patentable if their function is significantly altered because of the isolation. This result depends upon the court buying Myriad's argument that cDNA is the equivalent of recombinant DNA whose sequence is designed by the inventors. One risk of the decision for patentees is that the court appears poised to place additional weight on the obviousness analysis. Here, it is also clear that the court does not trust the USPTO to make these determinations. As Justice Kagan mentioned "the PTO seems very patent happy".

AMP's attorney Chris Hansen began his argument with the strongest possible approach – arguing that Myriad's recognition that the BRCA genes "correlate with an increased risk of breast or ovarian cancer . . . [was] made by nature . . . [and] Myriad does not deserve a patent for it." Mr. Castanias disagreed – "What Myriad inventors created in this circumstance was a new molecule that had never before been known to the world."

A first focus of the argument was on whether the isolated DNA has a new function – different from that found in the human body.

JUSTICE ALITO: Isolated DNA has a very different function from the DNA as it exists in nature. And although the chemical composition may not be different, it — it certainly is in a different form. So what is the distinction?

MR. HANSEN: Well, I don't think it has a new function, Your Honor, with respect. I believe that what — Myriad has proffered essentially three functions for the DNA outside the body as opposed to inside the body. The first is we can look at it. And that's true, but that's not really a new function. That's simply the nature of when you extract something you can look at it better.

The second two rationales that Myriad has proffered are that it can be used as probes and primers. Three of the lower court judges found that full-length DNA, which all of these patent claims include, cannot be used as probes and primers. But more important, finding a new use for a product of nature, if you don't change the product of nature, is not patentable. If I find a new way of taking gold and making earrings out of it, that doesn't entitle me to a patent on gold. If I find a new way of using lead, it doesn't entitle me to a patent on lead.

As I mentioned, everyone recognizes that Myriad made a major advance in our understanding of human genetics. The focused then turned to how Myriad should be rewarded.

JUSTICE KAGAN: Mr. Hansen, could you tell me what you think the incentives are for a company to do what Myriad did? If you assume that it takes a lot of work and takes a lot of investment to identify this gene, but the gene is not changed in composition, and what you just said is that discovering uses for that gene would not be patentable even if those new — even if those uses are new, what does Myriad get out of this deal? Why shouldn't we worry that Myriad or companies like it will just say, well, you know, we're not going to do this work anymore?

MR. HANSEN: Well, we know that would not have happened in this particular case, Your Honor. We know that there were other labs looking for the BRCA genes and they had announced that they would not patent them if they were the first to find it. We also know that prior to the patent actually being issued, there were other labs doing BRCA testing and Myriad shut all that testing down. So we know in this particular case that problem would not have arisen.

But the point of the whole — the whole point of the product of nature doctrine is that when you lock up a product of nature, it prevents industry from innovating and — and making new discoveries. That's the reason we have the product of nature doctrine, is because there may be a million things you can do with the BRCA gene, but nobody but Myriad is allowed to look at it and that is impeding science rather than advancing it.

MR. HANSEN: [Further], taxpayers paid for much of the investment in Myriad's work. I [also] think you get enormous recognition.

SCALIA: Well, that's lovely.

MR. HANSEN: But I think that we know that that's sufficient. We know it's sufficient with respect to these two genes. We also know it's sufficient with respect to the human genome.

JUSTICE KENNEDY: But I just don't think we can decide the case on the ground, oh, don't worry about investment, it'll come. I just don't think we can do that.

The patented cDNA is not found in the human body, but instead was manufactured by the researchers by using a discovered enzyme to convert mRNA created in the body back in to the more stable DNA form.

JUSTICE SOTOMAYOR: [cDNA] is artificially created in the laboratory, so it's not bound in nature. It's not taking a gene and snipping something that's in nature. And yet you claim that can't be patented. The introns are taken out, the exons are left in, and they're sequenced together. Give me your brief argument on that. I read your brief, but it is not a product of nature; it's a product of human invention.

MR. HANSEN: There are two big differences between cDNA and DNA. The first is exactly the one Your Honor just discussed, which is that the introns, the noncoding regions, have been removed. That is done in the body, by the body. That's done in the process of DNA going to mRNA. What the scientist does who's creating the cDNA is they take the mRNA out of the body and then they simply have the natural nature-driven nucleotide binding processes complement the mRNA. So that if the mRNA has a C, the scientist just puts the corresponding nucleotide in there and nature causes them to bind up. The scientist does not decide -­

JUSTICE BREYER: I know, but I don't see the answer, because I gather, if I — if I've read it correctly, that when you have an R — the messenger RNA does not have the same base pairs. There's a U or something instead of an A or whatever it is.

MR. HANSEN: Yes.

JUSTICE BREYER: So when you actually look, if you could get a super-microscope and look at what they have with the cDNA, with their cDNA, you would discover something with an A, not a U. Is it AU? Is that the one?

MR. HANSEN: Yes.

JUSTICE BREYER: Okay. Okay. So — so you would discover something with an A there, you see, and you wouldn't discover something with a U there. And there is no such thing in nature as the no-introns AGG, whatever, okay? It's not there. That's not truly isolated DNA. But you can go look up the Amazon, wherever you want. Hence the question. Now, on that one, how? How is that found in nature? The answer is it isn't.

MR. HANSEN: Well, but I would suggest, Your Honor, that the question is not whether it is identical to something in nature. The question is whether there was a human invention involved, whether it is markedly different from what is found in nature.

JUSTICE SOTOMAYOR: But that goes to obviousness. That does not in my mind go to the issue of whether it's patent eligible. You may have a very strong argument on obviousness, but why does it not -­it's creating something that's not found in nature at all.

. . . CHIEF JUSTICE ROBERTS: But I — I thought the basic general approach here was we have a very expansive view of what is patent eligible and then we narrow things through things — issues like obviousness and so on. Why — wouldn't it make more sense to address the questions at issue here in the obviousness realm?

. . . . JUSTICE ALITO: This case has been structured in an effort to get us to decide this on the broadest possible ground . . . it's just about 101, it's not about any other provision of the Patent Act. Why should we do that?

. . . . JUSTICE BREYER: Ah. Then — then watch what you're doing. That's very, very interesting, because, really, we are reducing, then, 101 to anything under the sun, and — and that, it seems to me, we've rejected more often than we've followed it.

As it should, the discussion eventually worked its way to the patenting of ideas.

JUSTICE SOTOMAYOR: That's a failure of the patent law. It doesn't patent ideas.

MR. HANSEN: And it shouldn't patent ideas, and — but it also makes the point that isolated gene and the gene in the body are the same.

. . .

GENERAL VERRILLI: The claim that isolated DNA is a human invention rests entirely on the fact that it is no longer connected at the molecular level to what surrounded it in the body. But allowing a patent on that basis would effectively preempt anyone else from using the gene itself for any medical or scientific purpose. That is not true about a patent on cDNA. A patent on cDNA leaves the isolated DNA available for other scientists and other — and others in the medical profession to try to generate new uses. . . . [T]he position of the United States is that [as a conceptual matter] cDNA is patent eligible.

. . .

JUSTICE KAGAN: The first person who found a chromosome and isolated it, I think we can all say that that was a very useful discovery. And the question is, can you then — can the person who found that chromosome and isolated it from the body, could they have gone to the PTO?

A decision in the case is expected in June.

201 thoughts on “AMP v. Myriad Gene Patenting Oral Arguments

  1. Mooney, these things do not reflect any underlying physical reality, they are decisions that are made by society.

    So, it’s not circular, because the starting-point of the inquiry is wherever the initial decision lies.

    For instance, take my statement that you italicized. Now think about Prometheus, or any claim in your “old steps/new thought” paradigm. There are certain things on which it must at some point be decided that society is in agreement to the extent that a rule can be stated–for instance, that merely thinking about something does not impart to an otherwise old process a quality that renders it worthy of patent protection.

    In other words, we decide that it isn’t patent-eligible, the first part of my statement.

    Use a physics trick, and take this to the extreme: imagine a method claim that recites nothing but thinking about something. Nobody whose opinion matters would currently suggest that such a claim was worthy of patent protection, and it is therefore not patent-eligible. In such a case, my statement above is true, because there is literally no way any substantial utility could be asserted.

    Now, I don’t know that my statement has any effect beyond the “thinking” types of claims–but it might. And even if it doesn’t, it is an elegant way to articulate under the law why those claims are not patent-eligible.

    Conversely, anything for which a substantial utility CAN be asserted will be patent-eligible, but since 101 utility dovetails with 112 how to use, the scope of any granted patent will be delimited by that combination of 101/112, and that scope will be reflected in how the claims are actually drafted.

    So if you accept the premise that the decision has been made, the proposition is not circular.

    I’m not sure I understand you correctly, but I think it’s an incredibly easy argument to make persuasively that a new information-processing method lacks substantial utility if it is performed entirely in the mind.

    Maybe it is because we are talking with different understandings of “substantiality”. I think I have posted mine here somewhere before, I will try to find and link to it. It’s not entirely whole cloth, IIRC! And IIRC it is easy to buy into, for a court.

  2. NWPA said: “Why are people going to make these discoveries without any incentive?”

    I say: Beats me – without the incentive of patents, technological innovation cannot occur. Scientists will have no desire to discover and invent new stuff without patents. It’s mind boggling that people do not understand this simple concept. Consider the ancient Romans and Greeks, they did not have patents, so they never came up with anything. Unbelievable.

  3. In other words, the 3-D structure (and tertiary structure for that matter) does not affect what protein a particular gene encodes only the primary structure (i.e., sequence).

    Mike, the claims we are talking about are directed to a 3-D structure. What aspect of DNA do you think RNA polymerase recognizes? Do you think it reads a book about the DNA sequence so it knows where to land? C’mon.

    DNA’s main utility (storing genetic information) is not tied to its 3-D global structure.

    Certainly not true in humans.

    link to en.wikipedia.org

    And you could easily argue that RNA’s “main utility” is to store genetic information for translation by ribosomes. I’m still not buying the distinction you are making. To be clear, I’m not arguing that these molecules (DNA, RNA, protein) have the same function. I’m pointing out that a legal test which determines eligibility of a biopolymer solely based on whether the sequence of the biopolymer is comprised by a larger “naturally occurring” biopolymer is a very very bad test. But such a test certainly appears to be on the table, at least.

    To the extent it’s not on the table, we are looking at a pure utility test in which the similarity between the claimed sequence and a longer, previously undisclosed sequence “found in nature” is not relevant. Either the compostion of matter has a specific, substantial and credible utility or it doesnt. For example, a novel non-obvious cDNA with no known function (other than encoding an RNA or protein for further study) would remain ineligible under 101, just as expressed sequence tags were deemed ineligible under 101 many years ago.

  4. 6: As I understand it, the probes and primers are a subset of the more broadly claimed other claims. In which case, it is impossible for them to be more preemptive.

    Which claim is more “pre-emptive”?

    A. A drop of water.
    B. A circular lake filled with water.

  5. Nothing controversial about most of what you say, IBP. I think we’re in general agreement. I might quibble with an aspect of this:

    for things that aren’t patent-eligible, no substantial utility will be able to be asserted.

    Seems like there is some circularity here, no? Are you referring to the judicial exceptions? I think this is where we parted ways somewhat with the Prometheus claims. I think it’s a difficult argument to make persuasively that a new information-processing method lacks substantial utility simply because, e.g., it’s performed in the mind. I’m certainly not suggesting that such processes are eligible … just not sure about using 101 utility to get there.

  6. Discovery? No (the patent jurisprudence is pretty clear on that)

    Purification? Maybe (this still hinges on whether or not a change in kind has been effected.

    Information? No (sorry, but information only is not enough – to paraphrase Prometheus, you need something more)

  7. I think that the gene should be patent eligible. After all, it really isn’t any different than discovering some new chemical in the natural world in a plant for example and then extracting it.

    So, I think there are two good arguments for eligibility. Discovery and purification and information.

  8. It is an interesting comment actually.

    But, in reality, here you are saying they aren’t claiming the information—the correlation between a gene and cancer–but a method of detecting that gene. But, the method was well known. Extraction, probes, etc. All of that was well known.

    Isn’t it a fact that the only invention here is the discovery of the gene and relationship to cancer? I don’t see this as any different than Prometheus. It is just in Prometheus the level of [insert chemical] in the human body could be done in a routine blood test. Here, one has to do some fancy extraction and testing, but fancy testing that was well, well, known in the art. It could be said as well known as the blood test for the level of [insert chemical].

    Above, that is the reality of the situation. All the rest is just bundles of nonsense.

    Now, I haven’t read all the claims, but would one read on determining the structure of the gene using microscopy? What about a new method that has not been invented to discovery the structure of the gene?

    Please, be real here. You DNA guys are dancing as much as the information processing guys in computers to try to get people not to see the real invention.

    Utility: information: a prediction. Discovery: a relationship between a gene and cancer. Nothing else there. Everything else was well known.

    It is true that now the gene has been discovered that perhaps more tests can be performed to gain a greater understanding of the gene. And, there is no doubt massive utility to having to be able to isolate a portion of the DNA that is a gene for further testing and experiments.

  9. LOL.

    He chooses simply to never invoke the doctrine?

    Um, sure, did he patent those godly powers in his alternative universe?

    LOL – like he has a choice?

    C’mon 6, ignoring the valid points made is simply no answer.

    No answer at all.

    None.

    And none of his long winded, dust-kicking vacuous posts contain ANY answers.

    And they never have.

    So I have take your answer as ’6 is just clueless.’

    I can deal with that.

  10. Ok, but just so we’re clear then, you are predicting that specifically whether the change is enough to make a change in kind will be implicated directly in the opinion although that will not necessarily be the sole or main grounds for their opinion. Although you are open to other issues also being mentioned, or perhaps being the entire premise of the actual decision.

    As to your question about MM, I’m sorry I don’t understand what you were saying in your question. Although I think, if I had to guess at what you meant, that he has replied, on a number of occasions and his view is very long and I will not repeat it here for you in total. However, on the whole, he is not a fan of the product of nature/natural phenom/abstract idea judicial exception doctrine(s) and would seemingly prefer them to not be applied. Thus, he would “differentiate” by simply never invoking the doctrine under which the warehouse of nature becomes relevant. And I’m not sure why you really really really need him to spell this out for you. He has made it quite clear on a number of occasions it seems to me.

  11. I have to say though on the whole that Mr. Castinias’s little oral arg was pretty illuminating on a number of things. I really do wish that the Justices had grilled him a bit in re his assertions on preemption.

  12. No I mean the overall 3-D structure as opposed to tertiary structure (or interaction). I don’t think the tertiary structure of DNA is all that important wrt the utility that we are talking about (namely DNA as compositions that store genetic information). In other words, the 3-D structure (and tertiary structure for that matter) does not affect what protein a particular gene encodes only the primary structure (i.e., sequence).

    In this way, DNA’s main utility (storing genetic information) is not tied to its 3-D global structure. This usually does not apply to proteins and to some extent RNA (RNAs can store genetic information but they can also catalyze reactions). In that way proteins and RNA are more like traditional small molecules in that their function is closely tied to its 3-D structure and its 3-D structure can vary depending on the global primary structure. In other words, if you take a small fragment of RNA from a longer fragment and superimpose the 3-D structure of the smaller fragment onto the 3-D structure of the longer fragment, it may or may NOT overlap. Same with proteins. This is typically not the case for DNA since it is typically patented as a double strand rather than a single strand (as in proteins and RNA).

  13. “I mean, honestly, I think that Section 103 does this work better than Section 101,”

    I mean, your honor, I really think that inserting a red herring right abouts of now would really be the thing for me to do. Ifn your honor doesn’t mind.

    This guy argues like so many lawltar ds, I mean seriously guys, get your sht together and put the little birds away.

  14. “I — I think — I think, Justice Kagan, you’re really putting your finger on the problem with this, again, I — I keep wanting to refer to as the so-called Product of Nature Doctrine because I don’t believe that as a separate doctrine it really exists. It’s just the flip side of the coin of something that shows a lack of invention.”

    I find his lack of faith disturbing.

    As I’m sure the USSC does.

  15. “And then what the — what the Myriad inventors then did to create what is called SEQ ID number 2 and what is claimed in claim 1 of the ’282 patent is to take — actually manipulate that further to add in the introns. It was in — actually, the inventive process was additive.”

    Yeah that’s true, it does sound like you had an inventive process on your hands there, perhaps you should have patented that rather than the result of that process.

  16. Mike Following this logic, any DNA (whether it’s from humans or any other organism) with the same sequence as the cDNA should render the cDNA patent ineligible.

    Right, which is what I’m saying: whether you call the polynucleotide “cDNA” or “hDNA” or “pDNA” or anything else is beside the point.

    The question for eligibility is to first simply ask if the sequence exists anywhere “in nature” or in the prior art. If the only function of such a sequence is as a research tool for further study, then it’s ineligible. But if it has a substantial function (e.g., as a probe or a primer for diagnosing disease) then it is eligible for patenting (at least, that was the ACLU’s admission and appears to be the position of at least two Justices).

    Wrt to your examples of peptides and RNA, I think DNA is a completely different beast (esp in the context of genes) because the 3-D structure of DNA is not terribly important.

    You mean the tertiary structure. The 3-D structure of DNA is just as important for its function in vivo as the 3-D structure of any other molecule. That said, changing one base in the primary structure of DNA can be the difference between life and death so I don’t buy your argument at all. I don’t think you do either, frankly. It’s not wise to make sweeping legal rules about complicated chemicals based on how they “usually” behave. Many of the most interesting advances in bioscience/technology relate to molecules that behave unusually with respect to how the genus to which they belong was previously known to behave (e.g., ribozymes, deoxyribozymes, siRNAs, etc).

  17. “When you look at those particular sequences, there was invention in the decision of where to begin the gene and where to end the gene.”

    His very best argument is that there was invention in an abstract idea (aka the “decision”).

    Yeah, that’s totally going to work.

  18. “I find it very, very difficult to conceive how you can patent a sequential numbering system by nature, in the same way that I have a problem in thinking that someone could get a patent on the computer binary code merely because they throw a certain number of things on a piece of paper in a certain order.”

    The learned Justice Sotomayor speaketh the truth.

  19. The reason I wouldn’t be worried about the poor guy in your hypothethical is because that isn’t how DNA works.

    That’s a utility argument, and a rather extreme one that has not been put forth by any party to any of these proceedings that I am aware of. You’re suggesting that without a promoter (and maybe a replication origin or sequences for recombinant insertion into a chromosome?) the polynucleotide lacks substantial utility.

    Does your argument also apply to a polynucleotide encoding a protein that I designed from scratch? Do you consider it to be lacking utility unless I include a promoter? If not, explain why not.

    The standard response to your argument is that an isolated polynucleotide sequence encoding a protein with a known function is extremely useful for making vectors and recombinant organisms. Is that a non-substantial utility in your view? Again, that would represent a radical departure from current practice.

    I think the reason most scientists are fundamentally against patents on genes (and cDNA) is because essentially they are patents on information.

    Huh? Most scientists I know aren’t “fundamentally opposed” to patents on novel, non-obvious and useful protein or mRNA encoding polynucletoides. I’m a scientist and I’m not opposed. Bunch of scientists over at PatentDocs aren’t opposed. Is there some survey you’re referring to? Exactly what question was asked in that survey?

  20. Consider that this would have no effect on the scope of the patent of any article, composition, manufacture, or process, that was amenable to such an assertion of substantial utility.

    Is this wishful thinking? Based on law (which section)?

  21. I have not precluded other issues, 6.

    I have spoken on this particular subject.

    Do you think that Malcolm will also play along? Can you get him to answer the long, long, long asked question as to how he would differentiate (if allowed to patent) something from the warehouse of nature, free to all men with his patented item?

    It’s a really simple question that has always made him run and hide.

  22. Let’s consider that your claim is to the chemical compound known as human chromosome 12.

    Keeping in mind that utility must be SS&C, the question becomes how a utility should be asserted such that it will satisfy 101.

    It is at once apparent that a wide range of assertions of utility is possible, all the way from something like “preventing cancer”, to something like describing the chemical action of the compound in the presence of another compound that is a known carcinogen.

    There are sliding scales of SS&C, in particular in this instance of specificity and credibility, and they are intimately and inextricably connected with WD satisfaction of the “how to use” requirement of 112.

    The narrower and closer to the physicality of the actual compound is the asserted utility, the less WD there needs to be to satisfy the “how to use” 112 requirement, and vice-versa, with respect to specificity and credibility.

    If utility was asserted as “detecting carcinogens in drinking water”, in order for it to satisfy 101, the 112 “how to use” requirement would need to be successfully directed to said asserted utility, with respect to specificity and credibility.

    If it is, fine.

    If it is not, 101 fail for lack of specificity, credibility, or both.

    Consider, though, substantiality. Since there is a wide variety of options in how to assert utility in a situation like this, and since some of them will be substantial and other will not, my preference would be to require that a substantial one be asserted, because therein lies the tie to patent-eligibility of subject-matter under 101. Only assertions of substantial utility should suffice.

    Consider that this would have no effect on the scope of the patent of any article, composition, manufacture, or process, that was amenable to such an assertion of substantial utility. So, for things that are actually patent-eligible, no problem exists as long as care is paid to the drafting process–which is what we are paid to do.

    However, for things that aren’t patent-eligible, no substantial utility will be able to be asserted.

    Substantiality of utility can therefore act as just the type of bright-line filter that everybody is looking for in 101, as long as applications are well-drafted.

  23. It isn’t a “poison test” MM.

    “Let’s call it a “chemical that interferes with utility.” What’s the distinction?”

    That will depend on the “chemical that interferes with utility”.

    “in spite of the fact that the so-called “pre-emptive” effect of the probe claims is arguably even greater than that of the longer claims. ”

    Hmmm, I’m doubting this is the case, likely because the “argument” that “could be made” or whatever isn’t a good argument because the person who is about to make it doesn’t understand the preemption doctrine at all.

    As I understand it, the probes and primers are a subset of the more broadly claimed other claims. In which case, it is impossible for them to be more preemptive.

  24. “However, without access to cDNA, essentially all gene cloning applications are barred”

    I take it that you’re talking about the “recombinant” gene work they were talking about in the oral args. I’m going to be honest with you, while there is Flook which puts a prohibition on “field of use” limitations saving a claim from 101, other than that what you’re talking about simply isn’t a problem :(

    “n biochemical terms, cDNA vs. “gene” is a distinction without a practical difference.”

    If it be so then they may go down with the other claims. I’m simply too ignorant on the biochem to say definitively. However, I will tell you that the supremes likely will be as well, and thus will likely leave them undisturbed.

  25. It all depends on whether the change is enough to make a change in kind.

    The warehouse of nature must be maintained free to all men.

  26. “But more important, finding a new use for a product of nature, if you don’t change the product of nature, is not patentable. ”

    When did this happen?

  27. “let’s say I discover a microbial organism in the stomach of a blind grasshopper that lives in a cave in Madagascar. Before any disclosure, I further isolate a cDNA from that microbe and show that when it is injected into human hair follicle cells it causes hair to grow magnificently thick and fast. What would the policy rationale be for denying me a patent on the previously non-existing isolated DNA sequence encoding that protein (and nothing else), whether it’s a “cDNA” or a native DNA sequence?”

    The reason I wouldn’t be worried about the poor guy in your hypothethical is because that isn’t how DNA works. If you’re really just talking about gene therapy, then patent the construct that you would use to deliver that gene. In your hypothetical world, I actually wouldn’t have a problem with granting him a patent on using the cDNA for that purpose.

    I think the reason most scientists are fundamentally against patents on genes (and cDNA) is because essentially they are patents on information. We rarely care about the physical molecules except for when we need to extract information from them in some way – whether that is reading the sequence, producing the protein for which they code, looking at how variations correlate with diseases, etc. Even in Myriad’s claim they’re simply just want control over the information, a patent on the physical cDNA is just a means of doing that.

  28. Upthread I asked about Formstein (Germany) and Gillette (England) and so it is good to see the self-same doctrine in the USA caselaw, in that MM writes:

    “…there’s case law to the effect that the DoE can’t be used to capture the prior art or obvious differences between the claim and the prior art (i.e., equivalents which “could have been claimed” by the patentee).”

    Some things just come down to universal commonsense.

  29. DC If we have a situation where the mRNA molecules of the gene exist with introns removed, should you be able to patent the cDNA of the gene that you created simply by using reverse transcriptase on the mRNA?

    I agree with Hoffman. It depends on the facts and the claims and it should typically be addressed under 102/103.

    Just to ask the obvious question: let’s say I discover a microbial organism in the stomach of a blind grasshopper that lives in a cave in Madagascar. Before any disclosure, I further isolate a cDNA from that microbe and show that when it is injected into human hair follicle cells it causes hair to grow magnificently thick and fast. What would the policy rationale be for denying me a patent on the previously non-existing isolated DNA sequence encoding that protein (and nothing else), whether it’s a “cDNA” or a native DNA sequence?

    By the way, in all this talk about “cDNA”, we’re not even addressing the redundancy of the code. It’s not the original cDNA sequence that matters to applicants. It’s the sequence of any DNA that encodes a protein with the same sequence as the protein encoded by the mRNA.

  30. I think the attention is on cDNA because most organisms do not have the capability of producing cDNA on its own and in most cases will not possess a cDNA version of a particular gene. This seems to me a plausible way of reading our 101 statute. Following this logic, any DNA (whether it’s from humans or any other organism) with the same sequence as the cDNA should render the cDNA patent ineligible.

    Wrt to your examples of peptides and RNA, I think DNA is a completely different beast (esp in the context of genes) because the 3-D structure of DNA is not terribly important. That is not the case of proteins and RNA. If you take a longer protein or RNA strand and cut it up, the 3-D structure of the protein and/or RNA can be radically different (e.g., RNA bases which were involved in tertiary interaction may be involved in hairpin formation or amino acids previously forming an alpha helix will have a random structure now). These changes in “structure” can have a fundamental influence on the utility of the protein or RNA. This is usually not the case for DNA.

  31. Whether or not cDNA mimics “the natural DNA sequence” (whatever that is supposed to mean) depends on the context. If you’re looking for a stable genetic material from which you can produce proteins, then yes, cDNA mimics the genomic DNA.

  32. Ahh, I apologize, I see what you’re asking now. You’re correct, HIV reverse transcriptase does have some specificity for HIV genes. Exactly how specific it is for viral RNA vs. host mRNA I am unsure.

  33. Reread what I wrote, ‘austinap’:

    Dennis said the cDNA mimics “the natural DNA sequence.” I disagreed.

    The argument that a cDNA mimics the corresponding mRNA is much stronger, but that’s not what Dennis wrote.

  34. Dennis- the solicitor general’s stance is that the cDNA should be patentable since a human typically does not have the necessary enzymes (e.g., reverse transcriptase) in order to create the cDNA from the mRNA. Thus, the cDNA does not naturally exist in nature. Obviously, AMP believes cDNA should not be patentable but Hansen was on record during the oral proceedings that limiting patents to just cDNA would be huge step forward. That’s debatable.

  35. What is being claimed is a routine variation on something old.

    Then it would be obvious.

    What if it’s not a “routine variation”? Surely you aren’t suggesting that a non-obvious and useful chemical isn’t patentable or becomes ineligible just because I used routine steps to make it! Might as well just pull the plug on all article of manufacture claims if that’s your angle.

  36. Oops sorry I don’t think my comments are scientifically sound wrt to viral cDNA being incorporated into host DNA. Based on my limited understanding of transcription enzymes, I would think that reverse transcriptase would not work on a lot of host mRNA because the reverse transcriptase probably needs to recognize a certain sequence in order bind to the mRNA and start reverse transcribing. This sequence is native in the virus RNA genome but probably does not occur too many places in the host. Thus, my basic point is the same that the number of host genes reverse transcribed by a retrovirus is probably limited to select genes.

  37. Sorry for the redundant comment, Dennis — I read through the rest of your post and see that you do understand the distinction.

    As for your question, I have to say ‘it depends’. If you’re trying to patent the cDNA for a housekeeping gene (one routinely expressed at high levels), there’s likely a pretty good argument that such a claim is obvious in view of the art (under at least a couple of the rationales set forth in MPEP 2143). But if you’re trying to patent a rare transcript (say a conditionally expressed splice variant only expressed in a particular tissue type under very particular metabolic conditions that are not fully understood), there’s probably a pretty good argument that such a claim would not be obvious, for reasons of predictability and reasonable expectation of success, at a minimum.

    Either way, I’d contend that the most appropriate way to deal with such subject matter is under sections 102/103/112, not section 101.

  38. If the sequence of a particular cDNA exists elsewhere in nature, the cDNA would presumably become patent-ineligible subject matter.

    Okay … so why all the attention on cDNA, as if it’s something special? It’s not. Either the sequence of the DNA is identical to some sequence found “in nature” (whether that sequence includes additional DNA at either end or not … or any other modifications??), in which case it’s ineligible, or it’s not found “in nature”, in which case it’s eligible. And why all the focus on “human genes” when every living organism uses DNA as its genetic material?

    Again, if the “logic” isn’t cabined then we run into problems really quickly. What about novel non-obvious useful peptides that are later found as part of larger protein molecules in some organism? Or novel non-obvious useful interfering RNA molecules whose sequences are not “markedly different” from a longer RNA? What if it’s not clear that the longer RNA is even expressed? Is it enough to prove ineligibility for some expert to testify that it’s likely that even without a promoter the RNA will be expressed at some incredibly low level (once out of every millionth transcription in one out of a billion cells)? It gets crazy real quick.

  39. Well, that is essentially the entire question here, isn’t it? The mRNA of all of these cDNA sequences exists in nature. There are a few billion copies of the BRCA1 mRNA in your cells right now.

  40. David – Thank you for this comment. I have taken molecular biology courses and have used reverse transcriptase to get a DNA version of a gene having exons removed.

    Here is my question: If we have a situation where the mRNA molecules of the gene exist with introns removed, should you be able to patent the cDNA of the gene that you created simply by using reverse transcriptase on the mRNA?

  41. The Doctrine of Equivalents is a rule applied in the infringement context, but combine it with the maxim of “that which infringes is later, anticipates if earlier” – then what?

    I believe there’s case law to the effect that the DoE can’t be used to capture the prior art or obvious differences between the claim and the prior art (i.e., equivalents which “could have been claimed” by the patentee).

    Does this boil down to the same questions of functionality/utility that are swirling around?

    I don’t think so.

  42. Why do you say things like that MM?

    I’m responding to your statement: “the current witch hunt positions the SCOTUS has taken with Prometheus”.

    The claims in Prometheus were not claims to new methods of obtaining information that was previously not obtainable. Those methods are surely patent-worthy (note: this doesn’t old information-gathering/processing methods that differ only in the recitation of the type of information being gathered/processed).

    The claims in Prometheus were straightforward, naked attempts to claim the information (i.e., the correlation) itself, in the only context in which that information had any utility. That’s why those claims were tanked in a very reasonable 9-0 decision that will never, ever be overturned.

  43. Not my specific area of expertise, but I would imagine that the vast majority of the reverse-transcribed host mRNA does not get incorporated back into the host’s genome. More likely, it sits around in the cell for a period of time before it is ultimately degraded by host enzymes. A small amount is probably incorporated back into the host genome.

  44. Mike, I still am not sure just how to claim this. The discovery is the correlation, just as in Mayo. In Mayo, a routine, old, blood test was not sufficient, because the only thing new was the correlation, not the use of the correlation.

    I really don't know how to properly claim tests, where the test is old but the information is new. Perhaps here, just as Malcolm said elsewhere, the claim to DNA sequences short enough to be used as probes and primers is enough. Simply sequencing the genome would, I think, not infringe. But I am not sure.

  45. I strongly disagree that it doesn’t “mimic” the original genomic DNA or the mRNA. Depending on the context within which you’re using it, it can mimic either. If you’re trying to make a protein, cDNA absolutely mimics the genomic DNA in coding for an identical peptide sequence. If you’re interested in the sequence, then the cDNA mimics mRNA by providing the same sequence with the advantage being that it is significantly more stable than the latter.

  46. Yes but do retroviruses reverse transcribe random genes of their host or do their cDNA get incorporated, to a large extent, in the same places of their hosts’ DNA. If the latter is true then the number of host cDNA that is generated is limited. That was my basic point.

  47. Dennis, referring to “seemingly man-made complementary DNA that mimics the natural DNA sequence” is incorrect.

    cDNA is man-made and does not appear in nature — it’s made with a recombinant viral enzyme called a reverse transcriptase, which is an RNA-directed DNA polymerase that uses an RNA template to make a DNA copy of a sequence. And it doesn’t ‘mimic’ the natural sequence, it contains an identical copy of the coding sequences (exons) but lacks copies of the noncoding sequences (introns). The only version of a gene in something approximating that form that appears in nature is a messenger RNA (mRNA), which is the final form of an RNA molecule transcribed from the native gene and processed to remove the introns and splice the exons together.

    So I think the argument for patentability of cDNAs is pretty strong — it’s a closer case when talking about isolated genomic clones, which are identical except for the fact that they have been cut out of a larger DNA molecule (i.e., a chromosome).

  48. Even if a particular cDNA was “accidently” synthesized in the lab I don’t think it anticipates Myriad’s patent under current laws unless the sequences were published. I don’t think experiments in the test tube would constitute public use.

  49. They primarily reverse transcribe their own genes, however it has been shown that they also reverse transcribe host mRNA to a limited extent. Anexaminer’s point is scientifically sound.

  50. Night, we will agree that the discovery is information. But that by itself is not eligible under all the cases. One needs some practical application of the information to a useful end otherwise Prometheus was wrongly decided. If the routine blood test there to extract the information was unpatentable, then the routine formation of isolated DNA here should not be enough as well.

  51. Yes but I believe retroviruses typically reverse transcribe only a few genes that play large roles in their survival and multiplication. I’m not a virologist so I am not an authority but I believe many of these genes are well-known.

  52. “If the court authorizes cDNA and not isolated DNA, on what basis? I can see none to really distinguish the two. Both should be eligible or not and for the same reason.”

    I think this is right, and I think most scientists would agree with this point of view. cDNA vs. “gene” is a distinction without a practical difference from a scientific point of view.

    While allowing patents on the cDNA but not the gene would leave some relevant avenues of research available, it would block a great many that require any sort of gene cloning during the process.

  53. I believe that’s why the solicitor general said he will not get into the specifics of whether a particular cDNA is patent-eligible. I interpreted his statements as cDNA may be patent-eligible subject matter in principle but not always. If the sequence of a particular cDNA exists elsewhere in nature, the cDNA would presumably become patent-ineligible subject matter.

  54. Yes, there are some things you can do with the non cDNA gene. For example, most techniques that involve only looking at the DNA sequence would still be fair game. This would leave techniques like looking at single-nucleotide polymorphisms (SNPs, a technique used to identify variations such as those identified by Myriad), genome-wide association studies, etc.

    However, without access to cDNA, essentially all gene cloning applications are barred. This means that researchers don’t have access to the protein product of the gene. I don’t know what your biochemistry background is, but without access to the protein, the vast majority of the relevant biochemistry is unavailable to researchers. To be more concrete, for example, if you ever wanted to develop drugs that would target the protein, that is now essentially impossible because you can’t get the protein. In biochemical terms, cDNA vs. “gene” is a distinction without a practical difference.

  55. Clearly both patenting isolated and cDNA sequences of the mutation with a use restriction to probes and primers for the subject cancers would seem to do the trick.

    I don’t see isolation as doing the trick: leaf plucked from a tree ‘n all. The particular isolated form should be required to have gained markedly different functions, e.g. a fluorescent or affinity tag, functions not created just by “plucking” a shorter sequence from a longer one, for it to be claimed. That could certainly protect diagnostics dependent on primers and probes with attached tags attached. But diagnostics that didn’t require those extra functions wouldn’t infringe.

    Also not infringing: 1. Companies that just sequence your dna for you, but do not analyze the content. 2. Companies that just analyse your sequence for you, but do not do sequencing themselves. You can see where that leads …

  56. I’m not following your stream of consciousness posting, IBP. Read my comment carefully and think about the questions I’m asking. Imagine each of those facts are before the Supreme Court in this case. Detection of carcinogens is “an insubstantial” utility for a composition of matter? C’mon. Be serious.

  57. It is the correlation between a certain sequence at a certain gene and certain cancer that really is at issue in this case.

    Right, but the correlation is not being claimed. You can correlate to your heart’s content, right now. I just did. I did not infringe Myriad’s claims.

  58. Jim: .I wonder if AMP has though of invalidating Myriad’s Patent arguing its anticipated.

    No doubt they have, as the arguments have been made for them here and elsewhere all the way along.

    cDNA and native DNA are structurally very different.

    No, Jim, that’s not true except in the case where we are talking about the native DNA encoding for a specific gene, where that gene has introns, and a cDNA made from mRNA expressed from that gene. Those two DNA molecules have different sequences, it’s true.

    But consider this polynucleotide:

    ATGCGGAGGCCTATACGGACGTGTGTGATATATGTGCTGCTGCTGCTGCTGCT

    Is that a cDNA or a native DNA? You have the structure but you can’t tell me. That’s because the term “cDNA” merely describes the relationship of one sequence to another sequence (the “c” stands for “complementary” and refers to the mRNA from which the sequence is derived). It’s entirely possible for a cDNA sequence in one organism to be identical to a native DNA in the same organism or another organism. Would that cDNA still be eligible? How is that possible when it is identical to the ineligible native DNA sequence?

    That’s why a “cDNA” test for patent eligibility is a strange one. The Supreme Court could do a minimum of logical damage with a very narrow very rule (but one which they probably shouldn’t be creating without a lot more data): DNA molecules with sequences that can be found in the genome of a human are ineligible for patenting. And the rationale for that rule should not and need not go further than to say that human genetics is too important to be tied up in patents.

    Going further presents some real problems for other sectors of the chemical and biotech industry (other sectors besides so-called “personalized medicine”, which is the sector in least need of patent proctection). The worst arguments floating around out there could probably be used to deny eligiblity for all kinds of therapeutic compounds that nobody will ever bother developing without patent protection (contrast with, e.g., computer-implemented g-rb-ge like forwarding your Grandma’s email to your handheld device in your robot car etc.).

  59. Night, agreed.

    And, moreover, most on the court seem to get it, that the discovery was the information, the correlation. Indeed, that was even Sweet’s holding.

    So, given Prometheus, the real question is what has to be added to render the claims eligible since one cannot get a patent on information itself.

    Funk Bros., Flook and Prometheus ALL said that the added matter had to be inventive, citing Morse.

  60. But although there is asserted utility, that asserted utility is not substantial within the meaning and requirement of 35 USC 101.

  61. Initial detection can certainly be useful, because you won’t waste resources treating water that isn’t contaminated. Post-treatment verification of the effectiveness of the treatment is also certainly useful, to ensure the production of carcinogen-free water.

  62. Mere “detection” of something simply confirms its presence or non-presence to the limits of the test, the result of which is pure information, which is insubstantial.

  63. “Detecting” is insubstantial. 101 fail.

    OTOH, a method of removing carcinogens from water, or of separating water and carcinogens, would have a substantial utility.

  64. One more point, Sweet held the isolated DNA claim ineligible because they covered, preempted, the “information” contained in the sequence. This is issue, the real issue. That information is what makes the claims useful and it is the correlation between the information and cancer that is the discovery.

    Mayo.

    Law of Nature.

  65. 6: Hmmm, inter alia, the POISONOUS CHEMICAL?

    So there’s a “poison test” now? C’mon. Okay, it’s not “poisonous”. Let’s call it a “chemical that interferes with utility.” What’s the distinction?

    to my knowledge you’re also arguing that the claimed compositions did not have a substantial utility in the instant case just now up thread.

    Right, at least some of Myriad’s claims cover extremely long sequences that are not useful except as objects for further study. I’m talking about claims limited to probes and primers — the ones that do have utility and which the ACLU and at least a couple Justices admit are eligible in spite of the fact that the so-called “pre-emptive” effect of the probe claims is arguably even greater than that of the longer claims.

  66. Ahh, but the utility issues DO have standing.

    The answer to Roberts’ question is this: if you were looking at the patentability of these claims in the first instance, consideration of any possible grounds of rejection could be appropriate, under the banner of administrative economy.

    However, this is not the first instance. This is the last instance, where the rubber meets the road. Consider the original question: “Are human genes patentable?”

    In order for this question to be answered meaningfully using an obviousness analysis, it would be required that all “human genes” were determined to be either obvious or non-obvious. If that could be achieved, then fine–but it seems to me that any such outcome would be limited in its applicability to “human genes”. Of course the court could write all sorts of stuff, potentially expanding the scope of the opinion regarding obviousness.

    However, this is a good time to tackle 101, and not avoid the pressing issue. The case is here, the briefing has been done, it is all there. Let’s face it, neither the courts nor anybody in the patent system really understands what “obvious” means, and I don’t think the issue has been briefed sufficiently well here to admit of a meaningful analysis by the court. Remember, they’re not patent specialists.

    101, OTOH, is ready for decision, based on the Supreme Court’s own precedent in decisions like Brenner v Manson.

    Unless I’m missing something critical, which might well be the case. I have been so busy with tax season that I feel like I’ve forgotten entirely about Myriad.

  67. anon, after Mayo, do you really think the issue here is a Product of Nature exception?

    Doctors want to use the sequence to diagnose cancer. Simply rendering the specific sequence unpatentable, while authorizing claims to the use of the sequence for the discovered purpose hardly will solve that problem, will it? That kind of victory is Pyrrhic.

  68. bob, what is the invention, the discovery? It is the correlation between the mutation at a specific gene and a particular cancer.

    The problem is claiming the DNA sequence itself inhibits research into a genome in general, and other uses or functions of this DNA sequence.

    But the reason for this lawsuit, really, is that others want to use the discovery themselves to diagnose cancer. Doctors would say that anything that would prevent them doing this to save lives is truly unethical and immoral.

    The issues on the table are hardly the DOE.

  69. The first part may have been reasonable, but it was far from “good”.

    Hansen did a poor job here, and didn’t translate the “common sense” version into patent language.

    In the language of patents, “looking at something”, with nothing more, is an insubstantial utility, and such a statement of alleged utility would, by itself, be insufficient to satisfy the SS&C utility requirement of 35 USC 101.

    As for the situation where the molecules are “too long” to have utility as probes or primers–in patent language, this is known as an incredible utility. Such a statement of alleged utility would, by itself, be insufficient to satisfy the SS&C utility requirement of 35 USC 101.

    SS&C–Specific, Substantial, and Credible. Not my language, but the language of the law.

    See my posts below for why considering 101 over 103 matters.

  70. Hmmm, inter alia, the POISONOUS CHEMICAL? And to my knowledge you’re also arguing that the claimed compositions did not have a substantial utility in the instant case just now up thread.

  71. “If you want to do anything meaningful with this gene, you need to first clone it — and that always involves creating the same cDNA at some point in the process. ”

    Kev at patent docs gave me some examples of some things that you could do without making cDNA and promised there were many more. What he said seemed to check out.

  72. an examiner, I don’t think the issue is “product of nature” but “law of nature.” It is the correlation between a certain sequence at a certain gene and certain cancer that really is at issue in this case.

    Sweet himself identified the value of the claimed invention to be in the sequence.

    If Mayo stands for anything, and it was only recently decided, then something has to be added to the correlation and that something has to be “inventive.”

    If the court authorizes cDNA and not isolated DNA, on what basis? I can see none to really distinguish the two. Both should be eligible or not and for the same reason.

  73. cDNA and native DNA are structurally very different. J. Sotomayor correctly understood the distinctions – cDNA only contains Exons (protien coding sequence) whereas native DNA contains Exons (protein coding sequence) and introns (non-protein coding sequence). In my opinion as a former reseach assistant researching predisposing genes to cancer and synthesizing and using cDNA on a daily basis, I believe cDNA and native DNA do not perform substantially the same function. Native DNA’s function is to code for RNA in a process called transcription. cDNA is a synthesized strand of nucleaic acids typically used to perform screening assays for example. (May also be used as a probe) Because RNA is, in comparision, very unstable next DNA; those skilled in the art convert RNA into cDNA before sequencing it for aberrations.

    I wonder if AMP has though of invalidating Myriad’s Patent arguing its anticipated. Specifically, in the process of synthesizing cDNA, those skilled in the art use a primer which is non-specific and synthesizes, theoretically, nearly every RNA molecule in an RNA isolation sample. Argument simply being, before Myriad, someone has synthesized the cDNA of BRCA1 and BRCA 2 without knowing it.

  74. Is cDNA potentially a product of nature also?
    cDNA is basically DNA without exons. mRNA has all of exons stripped out however mRNA is converted into proteins not into cDNA.

    However, any person infected with a virus such as HIV will have reverse transcriptase present in there cells. So I did a little research and yes viral reverse transcriptase can act on host mRNA to form a cDNA copy. “Occasionally, reverse transcriptase will convert host mRNA into a cDNA copy.” – Molecular Biology by Clark

    Therefore claiming a single copy of cDNA is potentially claiming a product of nature (albeit an inadvertent product of nature).

    Instead of claiming a single cDNA molecule a better claim would be to a cDNA solution containing a certain number of copies of cDNA per ml which would not exist in nature.

  75. I wonder if the shoe finally dropped.

    Don’t confuse a dropping show with a boot that is coming to crush your insipid-what-do-you-mean-anon reprisals.

    And yes, all of this is archived.

  76. So is it safe to say that your modifiedprediction…

    Watch 6, as Malcolm slides the prediction to align with me (and watch how much that burns him so).

  77. Don’t tell anon

    LOL – what are you trying to do, change the subject and rain on my gloat-over-Malcolm parade?

    Plenty of time and space for railing against the intrusion of the judiciary into patent law later. For now, enjoy the wild dancing of Malcolm as he aligns with the views that I posted and that he could not ‘understand.’

  78. your readily understood dialogue

    LOL – you mean a ‘dialogue’ that you FEEL like having?

    cue the Cry-baby Veto machine

    The echo chamber of the little circle – nothing like it for ‘coherency’ of their own little world view.

    Too bad this world gets in the way of that. Too bad, so sad.

  79. You forgot about the word “effectively.”

    Strange, as you are the one that produced a post with the definition when Malcolm forgot that word.

    So very interesting how this forgetfulness comes upon you folk when your views fall out of favor.

  80. How much more clear than the “9-0 most definitely NO answer” do you want?

    Oh wait, you don’t want to open your eyes.

    Gotcha.

  81. It seems to relate to some kind of “product of nature” exception

    LOL – some kind?

    The little circle and their choice of ignorance.

    explain how it’s distinct from (1) known parts…

    Been there, done that – the ‘known’ part is a conflation of 102 and timing. Check out how Prometheus wrecked that dust-kicking.

    As to your (2), also see Prometheus and its line of thought about ‘enough.’

    Comic book argument? What is comic is the little circle insistence on ignoring the valid points raised and then saying “we the little circle members are so confused.”

    Like I said: the pathway to understanding is in front of you. But you have to open your eyes and chose to see.

  82. Not only anon. I never did understand how to reconcile the DoE with the “that which infringes..” saying. Can they be reconciled? I had supposed it must be possible (Formstein, Gillette and so on) but now I’m not so sure. But thanks anyway, LB, IANAE, for your readily understood dialogue.

  83. ” That is not true about a patent on cDNA. A patent on cDNA leaves the isolated DNA available for other scientists and other — and others in the medical profession to try to generate new uses”

    Except, this isn’t true at all. If you want to do anything meaningful with this gene, you need to first clone it — and that always involves creating the same cDNA at some point in the process. That is why the scientific community thinks that this is such a bad idea.

  84. I was thinking about the line of inquiry as to whether the “snippet” is “different” from what is found in Nature’s Warehouse.

    I’m not sure that’s a question it makes sense to ask. It seems to relate to some kind of “product of nature” exception, but until somebody can demonstrate that the exception exists and explain how it’s distinct from (1) known parts of nature as prior art, or (2) taking something unchanged from nature as negating “invention”, any discussion of it is essentially a comic book argument that will go on forever and resolve nothing.

  85. Understood, IANAE. Rather than anticipation/obviousness, I was thinking about the line of inquiry as to whether the “snippet” is “different” from what is found in Nature’s Warehouse. My question is whether the DOE approach would be a useful way to address that question.

  86. (think 101, not 102, and remember Prometheus, as well as Chakrabarty, and as for that matter, throw in Funk, hmm, sort of like I have been saying all along)

    Thanks for the clear answer, anon. That was awesome.

  87. DOE and anticipation…

    It’s a nice question, but not the question in front of the Court.

    (think 101, not 102, and remember Prometheus, as well as Chakrabarty, and as for that matter, throw in Funk, hmm, sort of like I have been saying all along)

    Does this boil down – lol, again see the 9-0 most definitely NO answer as provided by Prometheus.

  88. then what?

    Then the equivalent would have rendered the claim obvious.

    Infringement by equivalents isn’t real infringement. It’s the same liability as infringement, for something that is literally outside the claim. Judges made it up. Don’t tell anon, he’ll blow a gasket.

  89. I’d love to see a serious answer to this from someone who knows this case and knows the technology. The Doctrine of Equivalents is a rule applied in the infringement context, but combine it with the maxim of “that which infringes is later, anticipates if earlier” – then what?

    Does this boil down to the same questions of functionality/utility that are swirling around?

  90. Hi,

    Please forgive what may be a silly question but does the Doctrine of Equivalents have any place in this argument?

    Does Myriad’s snippet of DNA perform substantially the same function, in the same way to produce the same result as the gene as a part of the whole DNA?

    Cheers.

  91. In our collective pursuit of a coherent thread

    LOL – sounds more like the Crybaby’s Veto you attempted to pull off recently.

    After having been exposed as never wanting to have an actual conversation in the first place, you now seek ‘coherency’ in your soapboxing. Wouldn’t it be nice (for MaxDrie) if only those that agreed with his views ever spoke on these threads? How wonderful the ‘coherency’ of an echo chamber that would be.

    Of course, you would not be reflecting US law, but what does that matter?

    As for being comprehensible, it appears that more of those in the real world and practice have no troubles at all understanding (and repeating) what I have posted in such English-as-a-second-language that you and the little circle vacuously attempt to mischaracterize my posts as. Another source of your depression, no doubt.

  92. That has been established for 100 years or more and is true internationally… norms that are universally accepted

    Yep – had to check, but your absence from the Gleevec threads is now telling, when combined with your universal norms posted here.

    Or perhaps you intend to mean that merely having changed ends is not the critical point, or heck, even a very different form as in the Gleevec case…

    Is that what you meant Paul?

    Thanks.

  93. Poor MaxDrei,

    Pray tell, why so depressed? Tell. Do.

    Are you in peril as you attempt to misrepresent what I have actually stated?

  94. The reason no one can get their heads around this is information. The utility is information. The discovery is information. The entire point of this discovery is information.

    And, with the current witch hunt positions the SCOTUS has taken with Prometheus, and the current brain trust that has no idea of even how to frame questions regarding information, it is no great surprise that this simple issue has become so complicated.

    No utility? Information is the utility. The discovery is an informational discovery. The distillation of the leaves is by condensing the amount of time to find the outcome of the gene. You don’t have to wait to get cancer, you can determine the outcome (information) without waiting. Time is the number of leaves. The discovery is the gene on the vast chain of the DNA.

    So strange that we live in a time like no other where information has become the central engine of progress and yet the courts will not — or maybe do not have the education to— face the truth and understand it.

  95. First MM announces that he is not going to respond to anon. Then IBP announces regretfully that the thread can make progress only by ignoring anon. And then anon himself tells us to “ignore my words”.

    In our collective pursuit of a coherent thread, I think we might at last be getting somewhere.

    Mind you, reading this particular thread is no less depressing, even when it’s at least coherent and comprehensible.

  96. that is not the case before us.

    Really? What’s the distinction?

    Even the ACLU doesn’t see a distinction when it comes to the shorter pieces. You seem to. What’s the distinction?

  97. I love watching Malcolm and his wild dancing, all the time coming ever closer to the exact thing I predicted.

    So yummy!

    (and let’s remember Chakrabarty, a crystal (simple) to a plant (complex), though just discovered (and yes, that does mean even after a patent grant), is not ELIGIBLE. Note that this is explicitly NOT saying is not patentable.

    There is a difference. Ignore my words at your peril.

  98. “If the claimed composition is different from the prior art and what exists naturally, and the claimed composition has a specific, substantial and credible utility, it’s eligible.”

    Still gotta pass preemption, which is what is about to catch at least some o these buggers. Mark my words, the writing is already on the wall, Breyer shows that he clearly understands what is going on, what the effect and scope of the claims to the just plain ol’ “isolated” DNA is, and what will happen to those that do precisely what he knows they do.

  99. “But if I am the first to discover the sap and I identify a specific substantial utility that exists only after I “snip” some poisonous chemical out of it, I darn well should be able to get a patent on that man-made composition, regardless of how “conventional” the process is that I use to perform the “snipping”. ”

    That may well be the case, or it may not, but to my knowledge that is not the case before us.

  100. “It’s been said before but I’ll say it again: Myriad created problems for itself by asserting claims that were written more broadly then they needed to be and by asserting claims that were plainly invalid under 102/103. Why did they do that? They made Castanias’ job much more difficult, especially when a clear construction of the claims was never proferred. The ACLU’s expert testimony about “fragments existing in nature” could certainly have been anticipated and could probably have been erased by a reasonable claim construction (setting aside the possibility that the initial specification might lack support for claims of intermediate breath). But no. Myriad evidently wished to leave the term “isolated” as broad (and vague) as it possibly could be.

    So is it safe to say that your prediction is that this ship is at least partially going down?

  101. “There is no risk of a natural law or a
    physical phenomenon like energy or electricity,”

    How’s about the physical phenomenon of the loci of the BRCA genes?

  102. “these patents cover — these patent claims cover
    only what is claimed and no more.”

    So then, just like the claims in Benson, Bilski, and Prom? Because I mean, those patent claims covered only what is claimed and no more also…

    Which is a red herring that people time, and time, and time again, keep bringing up in response to the preemption problem. It would be nice to see the court roundly refute the logic (or whatever they’re calling their “logiclol” behind this nonsense argument). Just so that I can call the argument spurious with their official blessing in the future.

  103. Breyer, so close and yet so far:

    so that the compromise that has been
    built historically into this area is: Of course, if you
    get a new satisfying process to extract the sap from the
    plant in the Amazon, patented. Of course, if you get
    the sap out and you find that you can use it, you
    manipulate it, you use it, you figure out a way to use
    it to treat cancer, wonderful, patented. But what you
    can’t patent is the sap itself.

    Now, in any individual case that might be
    unfortunate or fortunate. But consider it in the
    run of things. It’s important to keep products of
    nature free of the restrictions that patents there are,
    so when Captain Ferno goes to the Amazon and discovers
    50 new types of plants, saps and medicines, discovers
    them, although that expedition was expensive, although
    nobody had found it before, he can’t get a patent on the
    thing itself. He gets a patent on the process, on the
    use of the thing, but not the thing itself.

    Yes, Justice Breyer, and that’s because the “thing itself” wasn’t created by me. I can’t claim “The sap from a plant” because I didn’t invent the sap. But if I am the first to discover the sap and I identify a specific substantial utility that exists only after I “snip” some poisonous chemical out of it, I darn well should be able to get a patent on that man-made composition, regardless of how “conventional” the process is that I use to perform the “snipping”. What is the policy for denying patents on such compositions? Who formulated that policy and why?

    Again, it all comes down to claim construction, as admitted by the ACLU. If the claimed composition is different from the prior art and what exists naturally, and the claimed composition has a specific, substantial and credible utility, it’s eligible.

    So once again: what exactly does the term “isolated” mean in the context of Myriad’s claims and how is it possible that the Supreme Court is even discussing a claim that has apparently never been construed?

  104. Castanias does eventually find his footing but it’s not clear to me that any of this part “stuck”.

    Justice Breyer, a point about no
    impermissible preemption before I sit down. Your
    opinion for the Court in Mayo made that very much an
    important point, but I think what you — what is
    important to understand here is that these patent claims
    aren’t for methods. They don’t prevent — present that
    problem that the Court identified in that argument and
    in the argument in Bilski. These are for specific
    molecules that exist in the physical world. That -­
    that concern that is present with method claims is not
    here, these patents cover — these patent claims cover
    only what is claimed and no more.

    There is no risk of a natural law or a
    physical phenomenon like energy or electricity, neither
    of which falls within the statutory categories. There
    is no risk of anything being preempted other than what
    the claims properly claim, which are human-made
    inventions of isolated molecules.

    And I think one last point to close on.
    It’s important to note that molecules have been patented
    for a very long time. That’s what drugs are. And drugs
    are often made by taking one molecule and another
    molecule, both of which are known, reacting them in a
    test tube, which is a very common thing, reactions have
    been around 100 years just like snipping has been, but
    they make something new and useful and life saving from
    that.

    CHIEF JUSTICE ROBERTS: Well, I don’t
    understand how this is at all like that, because there
    you’re obviously combining things and getting something
    new. Here you’re just snipping,

    Castanias would have done a lot better by pointing out that new and useful chemicals are invented all the time by “snipping” otherwise covalently attachd moieties off more complicated chemicals in the public domain. By itself, the “snipping” has never been an issue of subject matter eligibility and for good reason: the claim is to a man-made composition of matter.

    It’s been said before but I’ll say it again: Myriad created problems for itself by asserting claims that were written more broadly then they needed to be and by asserting claims that were plainly invalid under 102/103. Why did they do that? They made Castanias’ job much more difficult, especially when a clear construction of the claims was never proferred. The ACLU’s expert testimony about “fragments existing in nature” could certainly have been anticipated and could probably have been erased by a reasonable claim construction (setting aside the possibility that the initial specification might lack support for claims of intermediate breath). But no. Myriad evidently wished to leave the term “isolated” as broad (and vague) as it possibly could be.

  105. “But allowing a patent on that basis would effectively preempt anyone else from using the gene itself for any medical or scientific purpose. That is not true about a patent on cDNA. A patent on cDNA leaves the isolated DNA available for other scientists and other — and others in the medical profession to try to generate new uses.”

    Wow the official position of the United States of our Mericas’ is PRECISELY THE POSITION I HAVE ADHERRED TO FOR LIKE SEVERAL YEARS NOW. Glad to see that the United States of our Mericas’ have finally gotten around to pulling their heads out their arses.

  106. Among mainly painful moments, this part stands out.

    JUSTICE KAGAN: Mr. Castanias, could I take
    you away from the deference point and just ask again
    about the — the kind of law that you would have us
    make. Do you think that the first person who isolated
    chromosomes could have gotten a patent on that?MR. CASTANIAS: this case is about Section 101, I’m trying — I’m answering your
    question as though it’s about 101, patent eligibility.

    JUSTICE KAGAN: Yes.

    MR. CASTANIAS: Would it be obvious, would
    it be novel? I’m not sure. Those are different -­
    those are different analytical structures.

    JUSTICE KAGAN: Right.

    MR. CASTANIAS: But would it — and I think
    really, the — the statute does the work here. It is
    new and useful composition of matter -­

    JUSTICE KAGAN: But the first -­

    MR. CASTANIAS: — if it had use. If it had
    a new utility, then yes.

    If it’s a new composition of matter, it needs to be a specific, substantial and credible utility; the “newness” of the utility is not the question

    JUSTICE KAGAN: I’m sorry, because -­
    because — because, like Justice Breyer, I consider
    uses — patents on uses in a different category.

    Noooooooooooooooooo …… please, make it stop

    So I’m just asking, could you patent the
    isolated chromosome?

    MR. CASTANIAS: Again, I — I perhaps am not
    making myself as clear as I should. In Section 101, a
    patent claim must be shown to be useful; and that -­
    that is a utility that it has to be show

    Man, that is one depressing exchange.

  107. Any resemblance to a product of nature is a complete side-show

    Keep telling yourself that Malcolm. Keep telling yourself that.

    Maybe even you will believe your own spin.

  108. No, you may be eligible
    because you now take what was in the nature and
    was transformed in two ways. First, you will have
    is much more concentrated than it was
    nature, and secondly, that you took the role. if
    is not diluted, but works in
    concentrated form, which gave a new role. and
    - Changes in both their nature and gives
    New functionality may well have patents.

  109. IBP: All this talk of “utility” is getting me excited.

    I knew it would!

    MM, do you remember the discussion we had on the other thread about a length of iron on Jupiter? (IIRC)

    Vaguely. I definitely remember the utility issue always lurking around the corner in this case. I wonder if the shoe finally dropped.

  110. It’s still confusing to you because you are still trying to shoehorn this into an argument that does not fit.

    It’s a “you” problem that nobody but you can solve.

    (the good thing is the pathway is easy and clear: just listen to me)

  111. Also, anon–

    It pains me to say it, but ignoring your posts is the only way to move these blog comments forward.

    You’re going to have to clean it up again, and be productive.

    Seriously.

  112. All this talk of “utility” is getting me excited.

    MM, do you remember the discussion we had on the other thread about a length of iron on Jupiter? (IIRC)

    I look forward to commenting tomorrow…

  113. What is the argument that Myriad is making? That an isolated gene has additional utility- it is easier to study? I’m not sure I buy that argument.

    I’m not sure I buy it either. It’s about as flimsy a utility as you can get and similar utilities were shot down years ago as not specific or substantial enough.

    But it’s equally hard to understand all or any of the arguments the ACLU has been making in this case about “products of nature” and the like when the issue has apaprently been one of utility all along. Or would Myriad’s claims suddenly have become eligible if they had, say, done some comparison of the structure of the gene and postulated some specific non-research utility? (it’s pretty easy for a good patent attorney to come up with lots of those, with the inventor’s help of course ;)

    And if utility was the issue all along, why did the ACLU let the research method claims slide when those claims recite a use that the ACLU is now saying is too insubstantial for patenting? It’s all very confusing.

  114. What is the argument that Myriad is making? That an isolated gene has additional utility- it is easier to study? I’m not sure I buy that argument. Anything that is isolated from its native environment is inherently easier to study.

    I’m also not sure this is a great analogy because a medicinal leaf has direct utility by itself. I don’t think that’s necessarily true for an isolated gene. You need to compare the gene with a mutated version in order to have utility.

    MP

  115. JUSTICE SOTOMAYOR: But the patent with
    respect to claims that are not invalid would still
    stand.

    MR. HANSEN: That is correct, Your Honor.

    JUSTICE SOTOMAYOR: The primers and probes
    stand.

    MR. HANSEN: Would — would still remain.

    Wow. This is just bizarre. So the ACLU is making a pure utility argument after all! Any resemblance to a product of nature is a complete side-show. What an amazing concession. I’m floored.

  116. Fascinating portion of the transcript here where ACLU keeps wiggling away from the issues. It’s possible they lost their case right here:

    JUSTICE ALITO: But you’re making — you
    keep making the hypotheticals easier than they’re
    intended to be. It’s not just the case of taking the
    leaf off the tree and chewing it. Let’s say if you do
    that, you’d have to eat a whole forest to get the — the
    value of this. But it’s extracted and — and reduced to
    a concentrated form. That’s not patent — that’s not
    eligible?

    MR. HANSEN: No, that may well be eligible,
    because you have now taken what was in nature and you’ve
    transformed it in two ways. First of all, you’ve made
    it substantially more concentrated than it was in
    nature; and second, you’ve given it a function. If it
    doesn’t work in the diluted form but does work in a
    concentrated form, you’ve given it a new function. And
    the — by both changing its nature and by giving it a
    new function, you may well have patent -­

    JUSTICE ALITO: Well, when you concede that,
    then I’m not sure how you distinguish the isolated DNA
    here, because it has a different function. Will you
    dispute that?

    As disussed upthread, it wasn’t disputed that the function was different. The argument made by the ACLU was that the claims read on molecules that had no function (i.e., they lacked utility). My question is: is that true of all the claims at issue in this case? Are some of Myriad’s claims limited to shorter probes (that certainly do have utility, or at least a utility that has never before been challenged in this case)? If so, then we have a concession by the ACLU and no direct response to Alito’s questioning, which was a spot on.

  117. It’s bizarre that Myriad has not disclaimed those claims

    Let me add that’s equally bizarre for the US government to not acknowledge the fact that at lest some of Myriad’s claims should not have granted in the first place and would not have granted had the USPTO applied 102/103 to Myriad’s claims in the manner in which they’ve applied 102/103 to reject many many other similar claims. Why can’t the USPTO take at least these easy parts of the matter into its own hands?

    Heckuva job.

  118. Obviously [pun intended], they did not ask the right question.

    This too is archived. See my comments at the fifty year battle thread – there is a clear difference between patent eligibility and patentability.

    Ignore my words at your own peril.

  119. historically high grant rates

    LOL – try again Malcolm.

    Don’t let facts get in the way. The RATE was not and is not “historically high.”

    But then again, in your world, Kappos never did have reason to say “Quality does not equal reject

  120. Ned what kind of claim is it that allows the patenting of the correlation embodied in something practical?

    An eligible claim. ;)

    One will agree, in principle, that one cannot patent the idea of the correlation between the gene mutation and certain cancers, but one can patent a practical implementation.

    Here’s what I find fascinating: Myriad’s method method claims that recite using the identically claimed compositions simply as tools for conventional research (“let’s put it in a cell and see what happens”) were found eligible by the Federal Circuit and were not challenged by the ACLU. What happens to those claims if this

    In other words, from a policy standpoint, what is the point of denying eligibility to claims to novel compositions that are not “markedly different” from those found in nature but at the same time granting claims to all the broad, obvious methods of using those ineligible compositions?

  121. What is the prior art? The DNA sequence was unknown.

    Certain *long* DNA sequences were unknown, for sure. But, as I noted, many (all?) of the claims have a lower bound and no upper bound with respect to their length. The claims with short lower bounds (e.g., those covering 15 sequential nucleotides encoding an amino acid sub-sequence of a larger molecule) include within their scope many millions of short nucleotides, including tons that were previously known and disclosed.

    We discussed this issue way back when the case was first brought. It’s bizarre that Myriad has not disclaimed those claims but … they are a horrrible company with horrible people making decisions for them.

  122. Paul, the Federal Circuit focused on the chemical novelty, completely ingoring the SC remand after Mayo to consider the Law of Nature aspects, the correlation between the mutation and the cancer.

    The SC seems to recognize the need to protect this discovery, but not a claim that would prevent all uses of the preexisting DNA sequences involved for uses other than diagnosing the particular cancer risk.

    Where they draw the line here is what they are struggling with today.

  123. As Justice Kagen mentioned “the PTO seems very patent happy”. — does she mean that the Federal Circuit is very patent happy?

    I assumed she was referring to the historically high grant rates in the wake of numerous decisions that would theoretically make it more difficult to obtain a patent. Plus she’s got some pretty ridiculous claims in front of her in this case.

  124. Sotomayor addresses your concerns on pages 30-31, where she notes that the claim goes after cDNA subsequences of 15 bps or longer. She points out that there are 15 bp subsequences that fit within the span of a single exon and are therefore indistinguishable from the DNA isolate.

    It’s great to know that she has some familiarity with the facts and (presumably) will not fudge them if the Supreme Court tries to come up with some “cDNA test”.

    Those claims, by the way, are the claims that everyone agrees read on the prior art. It’s baffling why they are even being discussed but … that’s Myriad for you. A horrible company run by horrible people with some very poor legal counsel.

  125. What is the prior art? The DNA sequence was unknown. Ditto the correlation. Obviousness works on

    Prior Art.

    Are we considering 102(f)? That is repealed.

  126. in other contexts very soon

    Only too often shoved right back in your face after your anti-software patent rants, Malcolm.

    Or don’t you remember all the “not in my backyard” comments?

    Yes, those too are archived.

  127. Malcolm, I am not sure the court is aware that what they are asked to decide is a Law of Nature case. One will agree, in principle, that one cannot patent the idea of the correlation between the gene mutation and certain cancers, but one can patent a practical implementation. That is the law.

    So, what kind of claim is it that allows the patenting of the correlation embodied in something practical?

    Clearly both patenting isolated and cDNA sequences of the mutation with a use restriction to probes and primers for the subject cancers would seem to do the trick.

    Is that a proper claim form?

  128. – As Justice Kagen mentioned “the PTO seems very patent happy”. — does she mean that the Federal Circuit is very patent happy?

  129. PC it cannot be applied without invalidating most NCE claims in the pharmaceutical industry and also second medical use claims. The Supremes apprear to have realised this, from my skim read of the transcript.

    Huh? What part of the transcript are you referring to exactly?

    The Prometheus opinion ended by saying that no new rule of law has been created.

    That’s correct. A claim that protects ineligible subject matter is ineligible subject matter. And a claim that recites a “new” ineligible step and an old eligible step does nothing but protect the new ineligible step (at least from the viewpoint of those practicing the prior art). That was the case with Prometheus’ claim. That’s why it was ineligible.

  130. Sotomayor addresses your concerns on pages 30-31, where she notes that the claim goes after cDNA subsequences of 15 bps or longer. She points out that there are 15 bp subsequences that fit within the span of a single exon and are therefore indistinguishable from the DNA isolate.

  131. JUSTICE KAGAN: The first person who found a chromosome and isolated it, I think we can all say that that was a very useful discovery. And the question is, can you then — can the person who found that chromosome and isolated it from the body, could they have gone to the PTO?

    That’s an easy one: no, because there was no utility other than as a tool for further study when the chromosome was first isolated.

    But let’s throw in some different facts: let’s say at the time of filing it’s shown that an isolated human chromosome 12 is useful for detecting carcinogens in drinking water, where said carcinogens are responsible for the deaths of millions of children every year. Still no patent eligibility for the man-made isolated chromosome? What if it’s a man-made isolated dog chromosome instead of a human chromosome? What if it’s a man-made isolated chromosome isolated from an extinct bacteria in the stomach of a mosquito trapped in amber?

    Is the policy consideration human dependant or is there some mystical genuflecting to things that are not “markedly different” from those found in the “warehouse of nature” (occasionally referred to as “the universe” or, less boldly, “our planet”)? If the latter, can the Court at least recognize that there has never been anything close to a coherent description of this test that was distinguishable from an analysis under any of the other (non-101) patent statutes?

  132. You might want to bring that up with the self-purported (and self-defeating) champion of Prometheus, Paul: Malcolm.

    He still hasn’t squared Prometheus with the cases it depends on (Yes, I know that you know that such is a f001′s errand, so you would think that Malcolm is the perfect choice).

  133. One risk of the decision for patentees is that the court appears poised to place additional weight on the obviousness analysis. Here, it is also clear that the court does not trust the USPTO to make these determinations. As Justice Kagen mentioned “the PTO seems very patent happy”.

    Of course, the PTO is at least as inept at making proper determinations of patent ineligibility as they are at determining obviousness. That’s yet another reason why the government’s “solution” to the overclaiming by Prometheus came off poorly. After all, it was the USPTO who grant Prometheus its claim and a whole lot of other indistinguishable claims in the first place — including many of Myriad’s claims that are not even being defended by Myriad.

    Heckuva job, PTO. This chicken will come home to roost in other contexts very soon. Not necessarily a bad thing but there will be some hand-wringing by the patent bulls.

  134. this is the only time I’m going to address you< ?i>”

    LOL.

    LOL LOL LOL LOL LOL LOL LOL.

    LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL LOL.

  135. Can an eligible “cDNA” claim be rendered ineligible by a later showing that a bacteria or a fruit fly “created” a sequence that was not “markedly different” (to use the ACLU attorney’s phrase)?

    You keep asking this question, and yet you keep running away from the corollary set up and presented to you so very very very long ago.

    You also keep ignoring what Chakrabarty has ALREADY said on this.

    It’s as if you think you can control reality by only asking questions and never owning up to giving answers. Is that written on the hatband of your nice shiny hat?

  136. As I have said in many postings, I got NOTHING from Prometheus because there is NOTHING to get beyond mere pragmatism.

    Although there is a purported rule of law, it cannot be applied without invalidating most NCE claims in the pharmaceutical industry and also second medical use claims. The Supremes apprear to have realised this, from my skim read of the transcript.

    The Prometheus opinion ended by saying that no new rule of law has been created. It should be taken at its word.

    If the changed ends have created a new chemical entity, it is patent-eligible because new chemical entities are and should be patent eligible. That has been established for 100 years or more and is true internationally. No way around that without the US departing from norms that are universally accepted in the rest of the developed world.

  137. GENERAL VERRILLI: … A patent on cDNA leaves the isolated DNA available for other scientists and other — and others in the medical profession to try to generate new uses. . . . [T]he position of the United States is that cDNA is patent eligible.

    As I pointed in an earlier thread, there is no necessary structural distinction between a so-called “cDNA” and “isolated DNA.” It’s true a claimed nucleic acid composition that is based on an mRNA sequence as opposed to a chromosomal DNA sequence is less likely to read on a chromosomal DNA sequence. But it’s still possible for it do so, and more likely if the claimed polynucleotide is short.

    Also, the vast majority of living organisms do not have introns. Does the law only apply to human nucleic acid It doesn’t sound like it from the arguments. Can an eligible “cDNA” claim be rendered ineligible by a later showing that a bacteria or a fruit fly “created” a sequence that was not “markedly different” (to use the ACLU attorney’s phrase)? Does that subsequent creation event need to occur in a virgin forest or does the “warehouse of nature” include most of Europe?

  138. Paul,

    Like it or not, merely having changed ends is not the critical point.

    It never has been.

    The critical point is whether or not having those changed ends changes the item enough.

    If you got nothing else from Prometheus, you should have gotten that.

    Thanks.

  139. The question was never “Is it changed?” The question has always been “Is it changed enough?”

    Don’t tell it to me, trollboy. Tell it to the ACLU counsel. It was his comment that I was addressing. You’ll note that the term “enough” does not appear in his comment. Was that too difficult for you to follow, trollboy?

    Fyi, this is the only time I’m going to address you in this thread, trollboy. So troll on.

  140. As I understand it the ends of the isolated sequence are chemically different from the molecule as it exists in nature. In other words, the end groups at these positions are not found in nature.

    It may be a small difference. But our entire patent system is built on small differences and attention to detail. It would hae been good if these differences had been explained simply and strightforwardly in court – as I recollect they are well set out in the CAFC opinions.

    The invonvenient truth is that this was a new molecule not a product of nature. And in any event isolating products of nature and putting them into chemical compositions has been considered patentble for 100 years or more. Penicillin G and streptomycin were products of nature, as were many life-saving molecules.

  141. Roberts Why — wouldn’t it make more sense to address the questions at issue here in the obviousness realm?

    Great question. And not only obviousness but anticipation as well because every educated observer who has considered the question agrees that at least some of Myriad’s composition claims are anticipated.

    What’s the answer?

    The question arose in Prometheus, too, and there was a very good answer: to eliminate claims such as Prometheus’ claimed methods using a 102/103 analysis would require the Supreme Court to create a new rule about ignoring certain limitations (e.g., limitations reciting patent ineligible subject matter) when conducting an obviousness test.

    But those issues aren’t present when dealing with composition claims that are described structurally.

    So what’s the answer to Roberts’ question? The answer is that Roberts is absolutely correct (utility issues mentioned upthread notwithstanding).

  142. Why isn’t the discovery argument front and center? What they did was a discovery. Why are people going to make these discoveries without any incentive?

  143. Ah, but the claimed product is certainly changed from the natural product. There’s no dispute about that

    Nice strawman.

    The question was never “Is it changed?”

    The question has always been “Is it changed enough?”

    You need to understand why your aversion to “effectively” and your mental lapses as to what that term means have everything to do with your own personal dust-kicking going on here.

  144. MR. HANSEN: Well, I don’t think it has a new function, Your Honor, with respect. I believe that what — Myriad has proffered essentially three functions for the DNA outside the body as opposed to inside the body. The first is we can look at it. And that’s true, but that’s not really a new function. That’s simply the nature of when you extract something you can look at it better.

    Okay, so far so good. We’re looking at utility. Very reasonable.

    The second two rationales that Myriad has proffered are that it can be used as probes and primers. Three of the lower court judges found that full-length DNA, which all of these patent claims include, cannot be used as probes and primers

    Again with a reasonable utility argument: at least some of Myriad’s claims are broad enough (because they are written in comprising language and lack an upper bound on the length) to cover extremely long molecules that lack utility as probes or primers. So essentially Myriad is claiming something that is useful for further study — not at all unlike the situation with claims to so-called “expressed sequence tags” which were deemed ineligible under 101 as lacking substantial utility quite a few years back.

    This is the best argument against eligibility of Myriad’s claims, in my opinion. But does it apply to all of Myriad’s presently pending composition claims? I would have sworn there were some claims that were limited to shorter (typical primer/probe-length) molecules….

    But more important, finding a new use for a product of nature, if you don’t change the product of nature

    Ah, but the claimed product is certainly changed from the natural product. There’s no dispute about that, as Judge Alito recognized. Myriad’s claims do not read on any human chromosome that ever existed in nature. It’s claiming something else that anybody can immediately recognize as being different from any such chromosome. If that wasn’t true, there would be no Supreme Court controversy.

    If I find a new way of taking gold and making earrings out of it, that doesn’t entitle me to a patent on gold. If I find a new way of using lead, it doesn’t entitle me to a patent on lead.

    There’s nothing like some kindergarten level dust-kicking at the Supreme Court. Smell it!

Comments are closed.