Three new USPTO Satellite Offices: Denver, Dallas, and San Jose

Patent2011074On Monday, the USPTO is expected to announce the location of its three new satellite patent offices: Denver, Colorado; Dallas, Texas; and San Jose, California.  A fourth satellite office sited in Detroit, Michigan was particularly identified in the 2011 America Invents Act and is slotted to host a grand opening event next week (July 12).  The USPTO’s primary office will remain in Alexandria, Virginia –  just outside of Washington DC.  The satellite offices are expected to each house around 100 patent examiners and a handful of administrative patent judges.  These offices will also serve as check-in centers for examiners taking part in the PTO’s popular telework (work-from-home) program.  In addition, the satellite offices are expected to include high-quality teleconferencing equipment that patent applicants can use to conduct examiner interviews and argue appeals even when decision makers remain in DC.  Expect for the three new satellite offices to open in early 2013.

Although not tremendous, the new satellite office locations will serve as a boon for local patent attorneys and also local high-tech entrepreneurs.  A major open question is whether the USPTO will have the ability be able to hire and retain high-quality electrical engineers to staff its silicon valley patent office.

The USPTO continues to hire new patent examiners, administrative patent judges, and others. In particular, the Office currently has a “critical need for electrical engineers” but is also hiring mechanical engineers and chemistry gurus.

 

217 thoughts on “Three new USPTO Satellite Offices: Denver, Dallas, and San Jose

  1. Mr. 101, let's keep this simple.  Baby steps.

    Do you agree with the proposition that a law-of-nature, mathematical algorithm, or abstract idea to be eligible must be integrated into an otherwise eligible process?

  2. Then, IS it your position that the process that is modified by the law of nature a mathematical algorithm does not otherwise have to be eligible subject matter?  You seem to focus on the "e.g." I am sure you know that e.g. stands for "for example."  Thus you focus on the example, but apparently ignore the point.

  3. Mr. Heller:

    How insulting!!!! You already presented this argument above and I already responded to it. Yet you purposely present the exact argument again and ignore my detailed and cogent response already presented. You can do better than that and you know better than that. I have presented my original response again below, truncated for brevity but still with the substance of the “integration analysis” Now Mr. Heller, stop being a willful troll and engage in this debate or simply run away like 6 and MM.

    The M o T test and definition for 1800 processes is not definitive and most important not pertinent to the current Supreme Court holding of 101 statutory subject matter. Diehr was NEVER held to be locked into inventions of the 1800s. Although inventions of that type are still patent eligible. Besides the question being asked today of the CAFC is one of “integration”, not machine or transformation. Indeed Prometheus was struck in part because it depended on transformations from M o T as a basis for it’s holding.

    In Ultramercial the court and the inventors have agreed the concept is:“Using advertising as currency” Claiming a concept without applying it is considered an abstract idea. Abstract ideas, like a law of nature, or physical phenomena, are not patentable subject matter. Flook like Bilski only claimed math equations and thus claimed abstract ideas. The steps of the process did not “integrate” the concept into the process as a whole. So the question before the CAFC is as follows:

    Is Ultramercial’s claims an abstract idea in view of Prometheus?

    The answer is clearly no.

    The claims in Ultramercial are an inventive application of the concept. We know this is correct because of the way the steps of the process “integrate” the concept into the process as a whole. See Prometheus citing Diehr and Flook:

    “ Diehr and Flook, the cases most directly on point, both ad- dressed processes using mathematical formulas that, like laws of na- ture, are not themselves patentable. In Diehr, the overall process was patent eligible because of the way the additional steps of the pro- cess integrated the equation into the process as a whole. 187. These additional steps transformed the process into an inventive application of the formula.” (Syllabus Prometheus V Mayo 566 U. S. ____ (2012) )

    If Ultramercial’s claims were a mere application of a concept without integration they could read as follows:

    a method for using advertising as currency.
    1. offering a service
    2. accepting advertising as payment

    And if the specification to the above claims offered no further definition of the terms then the CAFC could rightfully rule Ultramercial’s claims to be an abstract idea based on the “integration analysis” used in Prometheus and referenced to Diehr. The claims would in effect be no more than simply stating the concept and saying apply it.

    See Prometheus as Authority (Still, as the Court has also made clear, to transform an un-patentable law of nature into a patent-eligible application of such a law, one must do more than simply state the law of nature while adding the words “apply it.” See, e.g., Benson, supra, at 71–72.) (( Opinion of the Court 3, Prometheus V Mayo 566 U. S. ____ (2012) )

    Ultramercial’s claims integrate the concept with 11 steps that when viewed as a whole and as an ordered combination offer more than the parts do separately. See Prometheus explaining why the claims as a whole are not fully integrated:

    “Finally, considering the three steps as an ordered combination adds nothing to the laws of nature that is not already present when the steps are considered separately.” ( Opinion of the Court 11, Prometheus V Mayo 566 U. S. ____ (2012) )

    Ultramercial’s steps can’t be completed in the mind and are not mental processes. Nor can they be completed with mere verbal instruction or with pencil and paper. The concept of the claim is still free to use in all fields and technological environments. Therefore the invention does not violate the pre-emption analysis from Benson. That the claims may be beneficial to conducting business on the internet is not a judicially created exception to statutory subject matter. Also that the claims do not provide detailed workings of conventional transformations, apparatus, and machines are also no barrier to statutory subject matter. Therefore the CAFC and The USSC should hold Ultramercials claims as statutory subject matter because the steps of the process “integrate” the concept into the process as a whole and thus transform the claims into an inventive application of the concept.

  4. e.g., processes that satisfy the MOT. That is the key language.

    Key? No. That is one of the holdings of Bilski. MOT as key was thrown out ( aclue is not a “key”). Prometheus took that dagger and twisted it, as teh claims there were acknowledged to have transformation and still (MOT being satisfied) ws not enough.

    It’s not even really that great a clue anymore.

    You are back to recycling arguments that have long been defeated. You have grown stale and boring.

  5. Mr. 101, integration into processes that are otherwise processes that the patent law is intended to protect, e.g., processes that satisfy the MOT.  That is the key language. 
     
    The integration, for example, of the math into the process in Flook was unavailing because the Flook process itself was abstract.  Ditto Bilski.
     
    Do you agree? 

  6. Yeah, he adds to Diehr the idea of “marketplace” processes from some Fed. Cir. decision written by the likes of either Rich or Rader. He simply refuses to acknowledge this from Diehr:

    Mr. Heller:

    Marketplace, business, industry are all the terminology of commerce and thus are inherent in the patent process. But let’s be honest here. You are simply trying to divert attention from the fact that the Supreme Court has held “integration” to be the key to transforming a concept into an inventive application of the process.

    You, Mr. Heller would rather float red herrings and engage in irrelevant word play and non existent arguments than face the on point case law that uses the “integration analysis” to determine patent eligibility. This despite the fact I have provided several detailed example of the analysis and use of the integration standard, of which you could contribute, critique, or provide alternatives. This behavior of yours Mr. Heller adds nothing of substance to the blog, law, and the patent community at large. You simply comport yourself to being a troll, a shill and nothing more.

  7. “The “concept” at issue can be any “concept” (aka abstract idea), not merely the one the inventors or a certain court dreams up. Anyone is free to dream up another. ”

    What’s crucial for you to understand 6 is that once the concept is “integrated” the process legally transforms into an inventive application of the concept and thus by law can’t be an abstract process. So go ahead 6, and dream up any concept you want. If you first establish, with a prima facie case that the concept you dreamed up, is the concept of the invention, then you will have to prove the concept is not “integrated” in the steps of the process. If no, the claim is not patent-eligible and should be rejected. If yes, the claim is patent- eligible, and the analysis is complete.
    Here is the formula based on the USPTO Guidelines:
    A ) Ultramercial is statutory
    This Ultramercial claim passes the Integration analysis as it is a process that includes the [ Insert Concept ] as a limitation, with additional steps that integrate the [ Insert Concept ] into the process and are sufficient to narrow the scope of the claim so that others are not foreclosed from using the [ Insert Concept ] in different applications.

    So go ahead 6, establish a prima facie case for your description of Ultramercials Concept. Then plug it into the above USPTO Guidelines based on Prometheus Integration Standard and see if it works. The USPTO set it all up for you. All you have to do now is perform.

    What are you waiting for?

    Chicken??

    Buck, Buck, Buck…

  8. Ya they need an office in FT.Myers Fl rarley over 90 or under 50. thats where I live here the primary attraction is having the worlds only inventor of significance me. So far no investors or customers wanting conception services though. That needs to happen first ive got a 35 billion doller patent portfolio but no attorneys want a piece of the contingent action. guess we will have to continue the depression until Oboma or someone wakes up and stops squandering and starts job and revenue creation and wealth

  9. “In Ultramercial the court and the inventors have agreed the concept is:“Using advertising as currency””

    They previously stated that was their position. Because they were not willing to listen to the higher courts. The “concept” at issue can be any “concept” (aka abstract idea), not merely the one the inventors or a certain court dreams up. Anyone is free to dream up another. Like, for instance, wildtangent, or me or you.

  10. Alright Mr. Wheeler, since you are super duper interested in this and you’re willing to put down your reasoning in a somewhat legible form, allow me to guide you into the correct conclusion. Let’s go slow so that when we get there you arrived there on your own without my divine intervention and only with my divine guidance.

    Step number one: Decide for yourself whether you believe that we must compare the claim to all abstract ideas of ever or whether we must compare the claim to only the “concept” (aka abstract idea) you have already recited.

    When you have decided let me know whether you decided that was the only abstract idea we had to compare the preemptive power of the claim against or whether we had to make sure there are no other abstract ideas that might be an issue. After you have informed me we will take the next step that is appropriate for you.

  11. Re: attracting folks to other locations (e.g., Phoenix).
    Denver was over 100 for several consecutive days a couple of weeks ago – and generally the area was spontaneously combusting (Ft. Collins, CO Springs areas + several more). If weather is the primary attraction – it narrows the choices dramatically!

  12. “advocating that integration would include integrating a LoN or Mathematical Algorithm into a process that itself is abstract.”

    Mr. Heller, the above is merely a straw man notion that essentially amounts to saying “a mental process being integrated into a mental process. Your point is logically redundant, makes no sense whatsoever, and has no relevance to discussing the Supreme Court precedent of “Integration”.

    However as noted, the Supreme Court has spoken on this. A L o N or a Mathematical Algorithm can be patentable subject matter if the L o N or Mathematical Algorithm is “integrated” into the process as a whole.

    See Prometheus V Mayo referencing Diehr, explaining how that equation was “integrated”: “The Court pointed out that the basic mathematical equation, like a law of nature, was not patentable. But it found the overall process patent eligible because of the way the additional steps of the process “integrated the equation” into the process as a whole. ” MAYO COLLABORATIVE SERVICES v. PROMETHEUS LABORATORIES, INC. Opinion of the Court”

    What’s crucial for you to understand Mr. Heller is that once the L o N or Mathematical Algorithm is fully “integrated” the process legally transforms into an inventive application of the L o N or Equation and thus by law can’t be an abstract process.

    If you would like further lessons on “integration analysis” I would be glad to assist you. You can start with analyzing Ultramercials claims in view of Prometheus.

  13. “Please define an “abstract idea”, 6 (and others)? Is it mental processes or something more?”

    An abstract idea is something you can do in your head, and or with pen and paper. The CAFC has really set the tone here with Cybersource and Ultramercial agreeing on that definition which is in concert with Supreme Court precedent on 101 statutory subject matter. See Bilski, Flook, Diehr. The “perform in your mind” definition sets well with the new ruling on “Integration Analysis” from Prometheus and adapted by the USPTO in the new Guidelines. Things are looking well especially for business methods and software. Know anyone that can execute a software program in their head? Or conduct business entirely within their mind? And now that Breyer has found a way to “integrate’ Flook and Diehr the door of patentable subject matter should remain wide open to promote the progress of the useful arts well into the 21st century.

  14. “The only thing about 101 which I’m prepared to go on at length about in this thread is the new guidance docs.”

    To borrow a phrase from Ronnie.

    t=There you go again!

    You are prepared to do no such thing. I challenged you to demonstrate your skill and use the “integration analysis” from Prometheus and the Guidelines to determine if Ultra’s claims were statutory subject matter. And you backed down like a cowed dog.

  15. “I already understood and dealt with the terminology prior to this decision.”

    Perhaps you have 6. But the point is there is no proof of that on this blog. So there is no choice but to assume you are ..well..lying. Since you in effect threw down the gauntlet by boasting that you were most knowledgeable on the “integration analysis” it’s more than reasonable to ask you to prove it. Since you claim to be an Examiner I will provide an example using the The Office Guidelines of how the claims in Ultramercial should be analyzed and what the outcome should be based on that analysis. Pay attention 6 and learn it well so that one day you truly will have the knowledge you pretend to have now.

    The USPTO Guidelines at #4 provide an example of how Diehr’s claims are “integrated” and therefore are an inventive application of the equation that is the focus of that patent.

    “4. This claim would pass Inquiries 1-3 in the above analysis as it is a process that includes the Arrhenius equation as a limitation, with additional steps that “integrate” the Arrhenius equation into the process and are sufficient to narrow the scope of the claim so that others are not foreclosed from using the Arrhenius equation in different applications.” link to uspto.gov

    The above analysis applies to Ultramercials claims as well. Let’s apply it now as follows:

    The Ultramercial claim would pass “the integration analysis” as it is a process that includes the concept of using advertising as currency as a limitation, with additional steps that “integrate” the concept into the process and are sufficient to narrow the scope of the claim so that others are not foreclosed from using the concept of using advertising as currency in different applications. For example it does not appear the claims would apply to plays, movie theathers, television programs, or cell phones. Most important steps 2-10 fully integrate the concept which results in transforming the process into the inventive application of the concept. In view of Prometheus and the Courts precedents Ultramercial claims statutory subject matter. And 6, that is how it’s done!

    See claims 2-10 below:

    a second step of selecting a sponsor message to be associated with the media product, said sponsor message being selected from a plu- rality of sponsor messages, said second step including accessing an activity log to verify that the total number of times which the sponsor message has been previously pre- sented is less than the number of transac- tion cycles contracted by the sponsor of the sponsor message;
    a third step of providing the media product for sale at an Internet website;
    a fourth step of restricting general public access to said media product;
    a fifth step of offering to a consumer access to the media product without charge to the consumer on the precondition that the con- sumer views the sponsor message;
    a sixth step of receiving from the consumer a request to view the sponsor message, wherein the consumer submits said request in response to being offered access to the media product;
    a seventh step of, in response to receiving the request from the consumer, facilitating the display of a sponsor message to the con- sumer;
    an eighth step of, if the sponsor message is not an interactive message, allowing said con- sumer access to said media product after said step of facilitating the display of said sponsor message;
    a ninth step of, if the sponsor message is an in- teractive message, presenting at least one query to the consumer and allowing said consumer access to said media product after receiving a response to said at least one query;
    a tenth step of recording the transaction event to the activity log, said tenth step including updating the total number of times the sponsor message has been presented;

    (ULTRAMERCIAL v. HULU 4)

  16. Mr. Heller:

    The T leg of the M o T test for 1800 processes is not definitive and most important not pertinent to current Supreme Court holdings of 101 statutory subject matter. The question being asked today of the CAFC is one of “integration”, not machine or transformation. Indeed Prometheus was struck in part because it depended on transformations from M o T as a basis for it’s holding. Now your good friend 6 is not yet mature enough, and so, is afraid to try the “integration analysis” analysis. How about you? Here is my effort below. Can you supply your own?

    In Ultramercial the court and the inventors have agreed the concept is:“Using advertising as currency”

    Claiming a concept without applying it is considered an abstract idea. Abstract ideas, like a law of nature, or physical phenomena, are not patentable subject matter.

    Therefore the question before the CAFC is as follows:

    Is Ultramercial’s claims an abstract idea in view of Prometheus?

    The answer is clearly no.

    The claims in Ultramercial are an inventive application of the concept. We know this is correct because of the way the steps of the process “integrate” the concept into the process as a whole. See Prometheus citing Diehr and Flook:

    “ Diehr and Flook, the cases most directly on point, both ad- dressed processes using mathematical formulas that, like laws of na- ture, are not themselves patentable. In Diehr, the overall process was patent eligible because of the way the additional steps of the pro- cess integrated the equation into the process as a whole. 187. These additional steps transformed the process into an inventive application of the formula.” (Syllabus Prometheus V Mayo 566 U. S. ____ (2012) )

    If Ultramercial’s claims were a mere application of a concept without integration they could read as follows:

    a method for using advertising as currency.
    1. offering a service
    2. accepting advertising as payment

    And if the specification to the above claims offered no further definition of the terms then the CAFC could rightfully rule Ultramercial’s claims to be an abstract idea based on the “integration analysis” used in Prometheus and referenced to Diehr. The claims would in effect be no more than simply stating the concept and saying apply it.

    See Prometheus as Authority (Still, as the Court has also made clear, to transform an un-patentable law of nature into a patent-eligible application of such a law, one must do more than simply state the law of nature while adding the words “apply it.” See, e.g., Benson, supra, at 71–72.) (( Opinion of the Court 3, Prometheus V Mayo 566 U. S. ____ (2012) )

    Ultramercial’s claims integrate the concept with 11 steps that when viewed as a whole and as an ordered combination offer more than the parts do separately. See Prometheus explaining why the claims as a whole are not fully integrated:

    “Finally, considering the three steps as an ordered combination adds nothing to the laws of nature that is not already present when the steps are considered separately.” ( Opinion of the Court 11, Prometheus V Mayo 566 U. S. ____ (2012) )

    Ultramercial’s steps can’t be completed in the mind and are not mental processes. Nor can they be completed with mere verbal instruction or with pencil and paper. The concept of the claim is still free to use in all fields and technological environments. Therefore the invention does not violate the pre-emption analysis from Benson. That the claims may be beneficial to conducting business on the internet is not a judicially created exception to statutory subject matter. Also that the claims do not provide detailed workings of convention transformations, apparatus, and machines are also no barrier to statutory subject matter. Therefore the CAFC and The USSC should hold Ultramercials claims as statutory subject matter because the steps of the process “integrate” the concept into the process as a whole and thus transform the claims into an inventive application of the concept.

  17. Hello Mr. Heller:

    Your friend 6 wilted when faced with the challenge to apply the “integration analysis” to the Ultramercial claims, as the Court has instructed the CAFC to do. Perhaps you would like a try? I have made it easy and even gone first with my own analysis. What say ye?

    In Ultramercial the court and the inventors have agreed the concept is:“Using advertising as currency”

    Claiming a concept without applying it is considered an abstract idea. Abstract ideas, like a law of nature, or physical phenomena, are not patentable subject matter.

    Therefore the question before the CAFC is as follows:

    Is Ultramercial’s claims an abstract idea in view of Prometheus?

    The answer is clearly no.

    The claims in Ultramercial are an inventive application of the concept. We know this is correct because of the way the steps of the process “integrate” the concept into the process as a whole. See Prometheus citing Diehr and Flook:

    “ Diehr and Flook, the cases most directly on point, both ad- dressed processes using mathematical formulas that, like laws of na- ture, are not themselves patentable. In Diehr, the overall process was patent eligible because of the way the additional steps of the pro- cess integrated the equation into the process as a whole. 187. These additional steps transformed the process into an inventive application of the formula.” (Syllabus Prometheus V Mayo 566 U. S. ____ (2012) )

    If Ultramercial’s claims were a mere application of a concept without integration they could read as follows:

    a method for using advertising as currency.
    1. offering a service
    2. accepting advertising as payment

    And if the specification to the above claims offered no further definition of the terms then the CAFC could rightfully rule Ultramercial’s claims to be an abstract idea based on the “integration analysis” used in Prometheus and referenced to Diehr. The claims would in effect be no more than simply stating the concept and saying apply it.

    See Prometheus as Authority (Still, as the Court has also made clear, to transform an un-patentable law of nature into a patent-eligible application of such a law, one must do more than simply state the law of nature while adding the words “apply it.” See, e.g., Benson, supra, at 71–72.) (( Opinion of the Court 3, Prometheus V Mayo 566 U. S. ____ (2012) )

    Ultramercial’s claims integrate the concept with 11 steps that when viewed as a whole and as an ordered combination offer more than the parts do separately. See Prometheus explaining why the claims as a whole are not fully integrated:

    “Finally, considering the three steps as an ordered combination adds nothing to the laws of nature that is not already present when the steps are considered separately.” ( Opinion of the Court 11, Prometheus V Mayo 566 U. S. ____ (2012) )

    Ultramercial’s steps can’t be completed in the mind and are not mental processes. Nor can they be completed with mere verbal instruction or with pencil and paper. The concept of the claim is still free to use in all fields and technological environments. Therefore the invention does not violate the pre-emption analysis from Benson. That the claims may be beneficial to conducting business on the internet is not a judicially created exception to statutory subject matter. Also that the claims do not provide detailed workings of convention transformations, apparatus, and machines are also no barrier to statutory subject matter. Therefore the CAFC and The USSC should hold Ultramercials claims as statutory subject matter.

    See ( Bilski Vs Kappos) Also see Ultramercial quoting Benson:“This breadth and lack of specificity does not render the claimed subject matter impermissibly abstract. Assuming the patent provides sufficient disclosure to enable a person of ordinary skill in the art to practice the invention and to satisfy the written description requirement, the disclosure need not detail the particular instrumentalities for each step in the process. That a process may be patentable, irrespective of the particular form of the instrumentalities used, cannot be disputed. If one of the steps of a process be that a certain substance is to be reduced to a powder, it may not be at all material what in- strument or machinery is used to effect that ob- ject, whether a hammer, a pestle and mortar, or a mill. Benson, 409 U.S. at 69-70 (quoting Cochrane v. Deener, 94 U.S. 780, 787-88 (1876)). Moreover, written description and enablement are conditions for patentability that title 35 sets “wholly apart from whether the invention falls into a category of statutory subject matter.” Diehr, 450 U.S. at 190 (quoting In re Bergy, 596 F.2d 952, 961 (C.C.P.A. 1979)). ( ULTRAMERCIAL v. HULU )

  18. Yeah actually it wasn’t the discoverer of genes, it was the guy that first isolated DNA from its surroundings back in the day and then worked on the human genome project. He got a nobel iirc. I don’t remember his name, I saw a program on it the other day.

  19. “You’re ice cold, 6. Nice try, though.”

    As ice cold as hel l. Although I may not be completely on fire just yet. You may be an influential lieutenant. But knowing you, I doubt it.

    As to whom “we” are, “we” are everyone. And as to where gene’s begin and NAC’s end well that is a great question. I’m not the expert here bro.

    As to whether or not non-ob (irrelevant) and useful (also irrelevant) compositions that carry information and are defined structurally in a manner that distinguishes them from the prior art should be ineligible, well, bro, that is a question for a court. At least one court said yep, and another said nope. And indeed I have yet to define “genes”. I don’t plan to either.

    If you’ll recall I washed my hands of this case when Kev told me that the claims at issue do not in fact preempt on natural genes, or even significantly preempt thereon. At that point I simply concede the matter because I’m not well enough briefed on the science and all. I do not have all the information I would need to be able to make an informed decision. If I were a judge in this case I would be asking questions like a mo.

  20. 6: We all know that what is valuable/useful about genes is not their chemical structure as such, or their chemical properties as such.

    Whose “we”? Where does a “gene” begin and a “nucleic acid composition” end?

    What they are valuable/useful for is the instructions they carry

    So novel, non-obvious and useful compositions that “carry information” and are defined structurally in a manner that distinguishes them from the prior art should be ineligible? Or is it only “genes” (a term which you haven’t defined)?

    I believe that was Judge Sweet’s position.

    Ah yes. Judge Sweet, known throughout the land for his brilliant positions on patent law and his deep understanding of biotechnology, typically scribbled in crayon on the courthouse bathroom walls.

    GSK. And you’re well aware why. It most certainly does not involve a tinfoil hat.

    You’re ice cold, 6. Nice try, though.

  21. Perhaps. But “genes” and “nucleic acid compositions” are non-identical (in spite of overlap).

    The beauty of “effectively” and “whatever” comes together in a symphony of “not eligible.”

  22. 6 As the discoverer of genes was reported to have said: “patenting genes was insanity”.

    Perhaps. But “genes” and “nucleic acid compositions” are non-identical (in spite of overlap). The “discoverer of genes” (Mendel?) probably knew as much about patent law as you do about biotechnology (which is to say: dick).

  23. “Who’s “they”? And why do you believe that “they” are “one of my major competitors”?”

    GSK. And you’re well aware why. It most certainly does not involve a tinfoil hat.

    “Rather than answer, I’d recommend just putting the tinfoil hat away and quietly resuming your troll-bashing. Your modestly amusing when you stay on that terrain.”

    Don’t get so flustered you forget how to spell “you’re”.

    “By the way, what do your fellow Examiners in the 1600 art unit think about your position on nucleic acid composition claims? ”

    Good question, however I have to say that I do not know any examiners in 1600. It’s a big office.

    “Is a majority for or against the proposition that useful, novel and non-obvious nucleic acid compositions should be held ineligible whenever (before or after patenting) an identical (or hell, even a near-identical) sequence is found in the mitochondrial genome of an Icelandic rock shrimp?”

    I don’t know, but I doubt if they’re rearing to lose a portion of what I understand are fairly easy claims to examine (just pop in the sequence and the computer returns the results right?) Would be interesting to find out, perhaps you could talk to some of them when you have interviews.

    To be sure though, if it would make you happier then I can change my position (simply what the lawl says) so that you don’t have to worry about the subsequent discovery in the belly of a shrimp in iceland. We could just say “NO” to genomic claims etc period. As the discoverer of genes was reported to have said: “patenting genes was insanity”. That is an acceptable position. We all know that what is valuable/useful about genes is not their chemical structure as such, or their chemical properties as such. What they are valuable/useful for is the instructions they carry on how to make a more complex life form. Funny enough, I believe that was Judge Sweet’s position.

  24. What a fxxxxin tool.

    Too late, that adjective is already owned by you.

    Of course, since the threads are given, you can actually prove Just The Facts wrong by quoting 6′s discussion of integration…

    T O O L

  25. very clear and straightforward advice

    LOLZ

    Cite please.

    Or is this more of the 6-style I-call-it-something-else-when-I-really-have-no-clue clarity?

    T O O L

  26. 6: they are one of your major competitors

    Who’s “they”? And why do you believe that “they” are “one of my major competitors”?

    Rather than answer, I’d recommend just putting the tinfoil hat away and quietly resuming your troll-bashing. Your modestly amusing when you stay on that terrain.

    By the way, what do your fellow Examiners in the 1600 art unit think about your position on nucleic acid composition claims? Is a majority for or against the proposition that useful, novel and non-obvious nucleic acid compositions should be held ineligible whenever (before or after patenting) an identical (or hell, even a near-identical) sequence is found in the mitochondrial genome of an Icelandic rock shrimp?

    Let us know, bro’.

  27. “circular non-answer”

    Just like the USPTO guidance!

    Actually the guidelines include some very clear and straightforward advice about the examination of [oldstep]+[newthought] claims. You should read them.

  28. Yeah, he adds to Diehr the idea of "marketplace" processes from some Fed. Cir. decision written by the likes of either Rich or Rader.  He simply refuses to acknowledge this from Diehr:

    "On the other hand, when a claim containing a mathematical formula implements or applies that formula in a structure or process which, when considered as a whole, is performing a function which the patent laws were designed to protect (e. g., transforming or reducing an article to a different state or thing), then the claim satisfies the requirements of § 101. "

  29. suckie: “Just The Facts” is a moniker chosen for its purely objective position that posts made to these boards should be factual and falsehoods and distortions should be exposed.

    I call “b-llsh-t” right there, suckie.

    What a fxxxxin tool.

  30. Ned, are you serious about having a discussion?

    No answer is your answer: No, Ned is not serious about having a discussion.

    If he was serious, he would have actually addressed the posts that point out the serious flaws in his position.

    He just wants to shill in peace.

  31. Is there any trolls (patrollers) in the house or investors without any the incumbants are winning and human advancement is dead. I am an NPE due to theft and exclusion consperacy is there a cival rights attorney in the house.

  32. circular non-answer

    Just like the USPTO guidance!

    translation: Wah Wah, it’s not what I want. QQ QQ.

  33. MM: How do I know if a composition of matter is a “natural phenomena”, suckie? What’s the test, suckie?

    suckie: did God/Nature make it? If the answer is yes then it’s a natural phenomena.

    How do I know if your deity made a composition, suckie? DOes he leave suction prints?

    In addition your circular non-answer, I noticed you didn’t apply your incomprehensible “test” to the hypothetical I presented. I’m not surprised, of course, because you are a troll. Nevertheless, the failure is noted.

    suckie That is simply letter typed on a computer screen.

    Man, this blog has the d-mbest trolls.

  34. And I’m through discussing it.

    From the data provided, did you even begin discussing “it?”

  35. “6, also make no mistake that AI is advocating that integration would include integrating a LoN or Mathematical Algorithm into a process that itself is abstract. Thus, in his view, the Bilski and Flook claims would be hunky-dory.”

    I have yet to see him advocate such, but if so, then he is sorely mistaken about whether or not that is a path to passing 101.

  36. “you have an obligation as a patent professional to learn and deal with the new level of terminology and subsequent conceptual analysis the terminology is directed to represent.”

    I already understood and dealt with the terminology prior to this decision. There is nothing new in the Prom decision other than them breaking down what I was already doing into bite sized chunks for kindergarteners unable to properly read the BFDB cases.

    That’s all I have to say mr. wheeler. I’m done being trolled by you in this here thread.

  37. “Isn’t this trolling?”

    No, and your continued inability to tell the difference is yet more evidence for why trolls like you exist. You simply have the wrong mindset. You seem to think that a statement being “untrue” has something to do with a comment being a troll comment or not. It does not.

    And furthermore my post was not to incite you to respond with your typical “hur hur hur put up or shut up” talk meant to get us to respond. My post was simply to inform you that my answer has been provided. You can take what has been given in the past or leave it, I’m not providing more.

    And I’m through discussing it.

  38. 6, also make no mistake that AI is advocating that integration would include integrating a LoN or Mathematical Algorithm into a process that itself is abstract. Thus, in his view, the Bilski and Flook claims would be hunky-dory.

    He simply will not agree, accept or understand that the underlying process (“claim as a whole”) itself must do something eligible, i.e., something physical.

  39. one of your major competitors“…. ?

    Hmm, it would make sense, given the shared views on process patents, ineptness with the written matter doctrine, too know-it-all-to-bother-with-actual-law and p1ss-poor brief writing…

    MM is a Lilly svck-up…

  40. Yes Sara but how many large items have you worked on the more money involved the larger the claim chances and with me and grandfathers in a 182 year old consperacy ,theyve stolen everything ,new security measures are needed but the legislators wont listen so far. Ive got plenty of work and ammo for those into dispute resolutions probably 40 items most already stolen and on the street products. Thats what ive been telling them is the odds are astronomical of coinventorship at the same time but they just put a new provision in AIA allowing it And also allowing the theft of the IP buy technical perfection disgusting!

  41. I already did.

    Isn’t this trolling? Stating something that is untrue to incite a response?

    Not quite the response you were hoping for?

  42. Michael,
    People thinking of the same thing at the very same time is almost impossible. I have Ideas that are years old and I continue to streamline them. And they still aren’t out there Michael. People that carry that flag are FOS!
    The only ones that I have lost out on are little gadgets. And gadgets are a constant.

  43. OK I got one if there splitting up the office in to multiple fragments in different cities then how will they determine first to file This move just creates more chances for IP to be stolen through multi office claims of dual inventorship when will they start integrity like immediate novelty check and lockering

  44. “Just The Facts” is not, nor is associated with, Mr. Wheeler, Actual Inventor, AI, or any other moniker chosen by that entity or any moniker chosen by anyone associated with that entity.

    “Just The Facts” is a moniker chosen for its purely objective position that posts made to these boards should be factual and falsehoods and distortions should be exposed.

    “Choosing not to” after boasting is no better than “not able to.”

    Bad choice to make and boast. Put up or shut up indeed.

  45. With Kaposes new technical perfection filing requirements instead of initial document disclosure program the britest new inventors can forget filing theyll need 200 years education to file in all fields that there idea may come from. Big business has it planed that way to clean up all for those foolish enough to file.

  46. “Integration is merely a word you, in your ta rdedness have latched onto for want of anything better to latch onto.”

    Apparently so has the USPTO, as the concept of integration, and the word itself, is used in four distinct sub sections of USPTO Guidelines for 101 statutory analysis. Changing everything from M or T to the buttressing Diehr’s Concept and Application Test/Analysis. So you best learn what it is and how to apply it.

    1. To show “integration”, the additional elements or steps must relate to the natural principle in a significant way to impose a meaningful limit on the claim scope. The analysis turns on whether the claim has added enough to show a practical application.

    2. Along with “integration”, the additional steps must be sufficient to ensure that the claim amounts to significantly more than the natural principle itself by including one or more elements or steps that limit the scope of the claim and do more than generally describe the natural principle with generalized instructions to “apply it.”

    3. A machine or transformation that is merely nominally, insignificantly, or tangentially related to the steps or elements, e.g., data gathering or data storage, would not show integration.

    4. This claim would pass Inquiries 1-3 in the above analysis as it is a process that includes the Arrhenius equation as a limitation, with additional steps that “integrate” the Arrhenius equation into the process and are sufficient to narrow the scope of the claim so that others are not foreclosed from using the Arrhenius equation in different applications.

  47. Thank you for doing this research and contributing these facts. I did not want to take the time to do it my self but actually assumed 6 was being truthful. Now we know he just outright lied. Apparently the “Integration Analysis” frightens him and is beyond his current intellectual capacity.

  48. 6: “I however prefer these simpler terms, as I am not a tar d.”

    I understand if the concept of integration is beyond your current intellectual capacity to deal with. However what you must learn is that words used in a legal context have different meaning than words used in ordinary everyday language. And when such words are introduced by the Supreme Court of the United states in a 9-0 decision, and adopted by the USPTO, you have an obligation as a patent professional to learn and deal with the new level of terminology and subsequent conceptual analysis the terminology is directed to represent. Your first mistake is assuming that integration is the same as pre-emption, as that concept was used in Benson. Pre-mption has it’s historical place and is currently still a tool in identifying abstract concepts. However pre-emption and integration are not the same thing. Here are the basics of the integration analysis. Learn them well because you will find this in the next guidelines issued by the Office.

    1. Integration is the key for determining a process is an inventive application of a concept.

    If the process is an inventive application of a concept the process is not an abstract idea and is therefore statutory subject matter.

    See From the Syllabus is Prometheus: “The Court pointed out that the basic mathematical equation, like a law of nature, was not patentable. But it found the overall process patent eligible because of the way the additional steps of the process “integrated” the equation into the process as a whole.” (12 MAYO COLLABORATIVE SERVICES v. PROMETHEUS LABORATORIES, INC. describing Diehr. Opinion of the Court) Emphasis added.

    2.In addition, if the concept is integrated in the process, there is no post solution activity .

    See USPTO Guidelines:

    Does the claim include additional elements/steps or a combination of elements/steps that “integrate” the natural principle into the claimed invention such that the natural principle is practically applied, and are sufficient to ensure that the claim amounts to significantly more than the natural principle itself? (Is it more than a law of nature + the general instruction to simply “apply it”?) 2012 Interim Procedure for Subject Matter Eligibility Analysis of Process Claims Involving Laws of Nature. ( Emphasis added)

  49. Why don’t we discuss what is on going and how illegal it is. Do you really think being hired by someone else makes it my responsibility to address?

  50. Funny that they are one of your major competitors is it not MM? Do try to not wear it upon your sleeve quite so much.

  51. I do not call it “integration”, because I am not a ta rd like yourself. Integration is merely a word you, in your ta rdedness have latched onto for want of anything better to latch onto. You dislike, for some reason, simply calling it the preemption analysis or analyzing the claim for trespassing a judicial exception. I however prefer these simpler terms, as I am not a tar d.

    I will provide scant reply to your additional trolling I’m afraid Mr. Wheeler.

  52. “Why can’t you demonstrate you skill on command right here in the present for everyone to see?”

    I am perfectly able to, I chose not to.

  53. It shouldn’t be hard to hire Examiners in Silicon Valley. Just find people who fail in engineering or private practice patent law, or those who prefer to smoke pot all the time. Then offer them a really high government salary and you’re set.

  54. There have been two threads on the Patently-O blog dedicated to the Ultramercial case.

    Every post by 6 on these two threads has been checked.

    Thread 1
    September 21, 2011: Ultramercial v. Hulu: Computer Programs and Patentable Subject Matter
    By Jason Rantanen

    31 posts by 6.

    Thread 2
    November 03, 2011: Ongoing Battles over Patentable Subject Matter
    By Dennis Crouch

    3 posts by 6.

    The total number of posts in which 6 visits the concept of integration: ZERO.

    Not even once.

    Put up or shut up indeed.

  55. my experiance is the patent office is a conspericy that is not going to allow any IP thats valuable to pass through with40 method of theft and no integrity in place They wont be going into my name. Ive got 40 on file and nothing but other companies doing corrupt file insertions and claim previous nonexistance existences and examiners wanting to use corrupted files run back in time to deny patents. I evan invented Hollywood MB games and matell and Mcdonalds cartoons Ebay and still no money. ya I could invent but I wont get compensated for it Rip Off!

  56. Ya we did get off track here I hope there placing there pants squarly very squarley is that better. Starting new offices when the patent quality is excellent ,but the subject matter ,due to whats Missing in AIA is definately the most important thing likley to pass through the new offices including the there plumbing.

  57. Art you say patents are not critical to human advancements so witch ones should you do without because I and my grandfathers have created them all and Ive never been paid or reciognized for any of them. I can assert the names and places where I created them and the fact that none of those individules is capable of creation any significant invention except with me in proxcimitous location that forms invention clusters that quickley exceed astronomical odds that prove I am the actual inventor and was frauded of the patents

  58. Why can’t you demonstrate you skill on command right here in the present for everyone to see? You are the one bragging. It’s now time to put up or shut up.

  59. I’ve defined it probably 15 times on this board. If you’re that interested go back and read all the old 101 threads.

    The only thing about 101 which I’m prepared to go on at length about in this thread is the new guidance docs. I’m not going to be trolled into a huge 101 discussion where you ta rds trot out your ta rdation for my amusement and to goad me into posting my views on the same subject for the thousandth time.

  60. “Then perhaps you wouldn’t mind a demonstration of your skill. How would you apply the “integration analysis” to Ultramercials claims?”

    I already did. Google Ultramercial PatentlyO and find the Ultramercial thread read down until you find my take.

  61. Wow this thread veered way off track. Does anyone know if the satellite offices will have culturally compliant facilities? The announcements didn’t seem to mention it. Hopefully the squat-dumpers won’t have to stand on the toilet seats in the new offices like they do now on the fourth floor of Jefferson. You know, modern Western-style plumbing and hygienic practices just aren’t for everyone.

  62. Please define an “abstract idea”, 6 (and others)?

    Is it mental processes or something more?

  63. Oh but michael if you are smart enough to invent, you are smart enough to invent some small things that will not take to much to produce. Then if you need start up money it won’t be a large amount. And when it gets out there they can’t truly squeeze you out. And eBay is there for the small items. Just set it up correctly. I plan to do my next two Ideas that way.
    And this is something I have said before which has nothing to do with my first paragraph. Why are we making the Cartoons and letting other countries poision our children with lead based toys? Their master plan … to make all our children McDonalds Employees forever. Ideal, Milton Bradley, Mattel etc., can’t you come up with another plastic like substance that won’t cause air quality problems and get back to making what our Children want. Man does not live by Movies alone. And even those are being made everywhere else. We’re even losing that Industry.

  64. you repeat a common and persistent fallacy mindlessly parroted by many patent professionals

    You want to talk about mindless parroting…? Check out “Against Intellectual Monopoly” by Boldrin and Levine. Oh wait, you already have.

    Yummy Kool-Aid there, lap it up comrade.

  65. “integration analysis” is the analysis which I’ve been advocating for these last 3-4 years. I know it well, and I know it much better than you do.”

    Oh really? Then perhaps you wouldn’t mind a demonstration of your skill. How would you apply the “integration analysis” to Ultramercials claims?

    A method for distribution of products over the Internet via a facilitator, said method comprising the steps of:
    a first step of receiving, from a content pro- vider, media products that are covered by intellectual property rights protection and are available for purchase, wherein each said media product being comprised of at least one of text data, music data, and video data;
    3
    ULTRAMERCIAL v. HULU
    a second step of selecting a sponsor message to be associated with the media product, said sponsor message being selected from a plu- rality of sponsor messages, said second step including accessing an activity log to verify that the total number of times which the sponsor message has been previously pre- sented is less than the number of transac- tion cycles contracted by the sponsor of the sponsor message;
    a third step of providing the media product for sale at an Internet website;
    a fourth step of restricting general public access to said media product;
    a fifth step of offering to a consumer access to the media product without charge to the consumer on the precondition that the con- sumer views the sponsor message;
    a sixth step of receiving from the consumer a request to view the sponsor message, wherein the consumer submits said request in response to being offered access to the media product;
    a seventh step of, in response to receiving the request from the consumer, facilitating the display of a sponsor message to the con- sumer;
    an eighth step of, if the sponsor message is not an interactive message, allowing said con- sumer access to said media product after said step of facilitating the display of said sponsor message;
    ULTRAMERCIAL v. HULU 4
    a ninth step of, if the sponsor message is an in- teractive message, presenting at least one query to the consumer and allowing said consumer access to said media product after receiving a response to said at least one query;
    a tenth step of recording the transaction event to the activity log, said tenth step including updating the total number of times the sponsor message has been presented; and
    an eleventh step of receiving payment from the sponsor of the sponsor message displayed.
    ’545 patent col.8 ll.5-48.

  66. I just cite common logic. If your smart and have top ideas then how could you commercialize them without protection. As soon as you launch your business idea the competition swarms in with more money to steal the market and squeeze you out so what incentive is there to create. Even with the corruption and 40 methods of theft in the system it has worked some what because at lest the ideas were valuable enough to be robed from the correct inventor. The system has had some noted lapses in this rule like the 1869-1882 economic depression era caused by the death of the worlds only inventor Isiah Roberts until his son got a gun at age 12 years to protect himself from being murdered like his mother and father at the hands of edison carnegie and clorox.Then the 1930-1954 era caused by the patent office corruptly awarding the patents in the wrong name instead of my other grandfather Delbert Roberts like theyve done to me now causing the third depression 2004 to 2012 It took to 2008 for it to take effect due to the bubble but the lack of marketable new products are now kicking in to cancel market expansion 1600are now black holed because of lack of incentive to create

  67. @Michael R. Thomas – Patents are NOT critical to human advancement – can you cite any credible studies/papers for your assertion? – of course you can’t. How did you come to this conclusion? Is it just what you think is needed? Social conditioning is unfortunately very powerful in modern society. Your post recognizes just some of the many problems why a patent system cannot work. What you apparently have not recognized is that will always be problems with a government state interventionist system – it cannot and will never work to benefit society – its very existence is the problem.

  68. @slashdot – you repeat a common and persistent fallacy mindlessly parroted by many patent professionals who never bother to dig deeper into what is really going on and the implications regarding the truths about patent and copyright law – this is very unfortunate – so much work, time and money is wasted on patents and copyrights. It is so unfortunate that so many entrepreneurs believe they need patents to succeed. Also, too, people think that just because they have a patent, it is a licence to print money, also like winning a lottery ticket on the way to business success. So many start-up companies waste huge amounts of money on trying to get patents, money that would be better spent on R&D in their business. Of course, the patent lawyers will encourage the entrepreneurs to get patents, because the lawyers get paid.

  69. Patents are critical to human advancements in all fields and always have been. Patent attorneys are disgusting in how they put all the patents that are valuable in the wrong names and stiffle significant invention were finally begining to see the effects of the corruption of the previous defective legislation and present AIA due to lack of inventor imput and paid off legislators favoring big business incumbants. If they want to see genuine economic recovery theyre going to need inventor intrests drafted legislation the sooner the bette. Theres nothing new in products coming on the market and were sinkingt into a double dip with government squandering money in every direction except the right one fund top invention concievers

  70. Funny then, that not a single advanced society today does not have a patent system.

    Oh how do we manage?

    [eyeroll]

  71. Patent law is illogical and pointless. Patents and copyrights should be abolished. Read the book: “Against Intellectual Monopoly” by Boldrin and Levine. Patents hinder innovation. Patent lawyers are the most arrogant lawyers that I have ever encountered – do some of you clueless people even realize that what you do doesn’t matter and actually causes harm? I have more respect for a slip-and-fall lawyer, at least they can actually help someone who is really injured. Patent lawyers just cause problems for people and society. There is NOT one credible study that shows that patents increase and are beneficial to technological innovation – NOT ONE. Patents are actually more like government-sanctioned, legalized theft. How many patent lawyers intentionally write claims that encompass already existing competitor’s products without disclosing it to the Patent Office in order to cause problems for competing companies?

  72. In case you missed it ya ta rd AI what you’re calling the “integration analysis” is the analysis which I’ve been advocating for these last 3-4 years. I know it well, and I know it much better than you do.

  73. MM’s LOLs turn to QQs.

    As in Prometheus, MM’s early exuberance is easily overstated, turning to tears.

  74. “Lulz, more mistaken “guidance” from the office. Apparently they think the analsis is different for abstract ideas vs. laws of nature/natural phenom. Silly USPTO deputy commissioner. It isn’t.”

    Grow up 6. The Office is simply being prudent until the CAFC reviews the two cases in light of Prometheus and the Court issues it’s final word.

    Most important we are seeing the supremacy of Diehr as controlling precedent, provide a legitimate avenue to keep business methods, and software patents issuing. Although things do not look so good for bio.

    You will be getting updated guidelines soon that will have little to nothing to do with Bilski for 101 purposes. And absolutely no room for dissection, and pre-emption when an “integration analysis” is applied.

    Remember it’s Diehr’s concept and application analysis that is controlling precedent, with Prometheus’s “integration” as the key to as the Court said: :transform the process into an inventive “application” of the formula. ( See Prometheus )

    “The Court pointed out that the basic mathematical equation, like a law of nature, was not patentable. But it found the overall process patent eligible because of the way the additional steps of the process integrated the equation into the process as a whole. Those steps included “installing rubber in a press, closing the mold, constantly determining the temperature of the mold, constantly re- calculating the appropriate cure time through the use of the formula and a digital computer, and automatically opening the press at the proper time.” Id., at 187. It nowhere suggested that all these steps, or at least the combination of those steps, were in context obvious, al­ ready in use, or purely conventional. And so the patentees did not “seek to pre-empt the use of [the] equation,” but sought “only to foreclose from others the use of that equa­ tion in conjunction with all of the other steps in their claimed process.” Ibid. These other steps apparently added to the formula something that in terms of patent law’s objectives had significance—they transformed the process into an inventive application of the formula.”

  75. Looks like suckie is getting the short end of the USPTO’s stick

    Because the long end is shoved up MM’s assumptions.

  76. I believe the guidleines indicate that the test is “the handiwork of nature and occurs without the hand of man

    Sort of exactly like what all these “suckies” have been telling you over the course of the last several hundred posts and at least three threads.

    If you still got a problem with that, take it up with Kappos.

  77. Let’s see our options:

    1) missing the point,
    2) erecting a strawman,
    3) attempting to derail the conversation.
    4) just can’t read.

    Well, since we read the actual Supreme Court decision and understood it well enough to recognize a pivotal feature of said decision, 4) is out.

    Since MM is trying to make a point that is false (that 102/103 is perfectly adequate to handle what is a 101 issue), and the counter point that we present (based in direct context of the Supreme Court decision) is quite on point, 1) is out.

    Since “erecting a strawman” means that we would have to be restating MM’s position in a false and easily knocked-down manner, 2) is out (make no mistake that the falseness is present in MM’s position and that position is easily knocked down, but that is not a strawman as we had no input in presenting that position in the first place).

    Since the conversation must have room for the true legal meaning to be presented (in such an august and decent legal forum), and since we present said true legal meaning, 3) is out.

    There is another possibility: You and MM are on the losing side (a badly losing side) of the legal discussion and keep getting your @_sses handed to you no matter how many threads you run too.

    My money is on this last one.

  78. MM: “What is exactly is a “natural phenomena”, suckie?

    Anything made by God/nature.

    MM: How do I know if a composition of matter is a “natural phenomena”, suckie?

    See the answer to the first questions

    MM: How about the following isolated nucleic acid sequence:

    How do I know if that is a “natural phenomena” or not, suckie?

    That is simply letters typed on a computer screen. If the letters can be decoded to actually communicate something then it’s simply a written description and not likely statutory subject matter for a patent.

    MM: How do I know if a composition of matter is a “natural phenomena”, suckie? What’s the test, suckie?

    Simple, did God/Nature make it? If the answer is yes then it’s a natural phenomena.

    Any more questions?

  79. “Aw shoot, I was going to ask MM what was missing from the guidelines, who really got the short end of the stick..”

    Like MM would have ever answered that question. No, that question is far to simple and requires far to honest an answer to even be worth MM’s time. Besides he is busy now trying to figure what to post now that his mental steps test theory has been completely ignored, and his 9-0 Suckie party has come to an end.

  80. otherwise decent forum for legal discussion

    Ned, are you serious about having a discussion?

  81. How high are the odds that the real “idjit” is the one that contradicts himself left and right? Who is so classless? Who cannot comport himself with any dignity whatsoever?

    (And yes, these are all rhetorical questions).

  82. Aw shoot, I was going to ask MM what was missing from the guidelines, who really got the short end of the stick. Did you have to spoil the surprise?

    MM, did you finish reading the guidelines yet?

  83. The guidelines reflect exactly what the Supreme Court told us in Prometheus. Integration is the key to statutory subject matter.

    Not MM’s whacky mental steps test theory.

    Not Ned’s MOT.

    You are both BIG losers!

    Diehr’ concept and application analysis has been buttressed by Prometheus integration. Now that Ultramercial, a so called business method, with software elements has been remanded back the CAFC, you will see the guidelines soon change to reflect ‘Integration” in those technology centers as well.

    The DCAT, for Diehr Concept and Analysis Test, will now be referred to as DCAIT, for Diehr Concept Analysis and Integration Test

    Bilsk’s MOT is dead and Ned’s entire online crusade in the wake of Bilski has been for nothing.

    And MM’s silly 9-0 Suckie Party has come to a bitter end.

    Integration is the future and the future is NOW!!

  84. And then, just for giggles, they use as an example of a claim not preempting a natural phenom/law of nature a claim which just so happens to claim an abstract idea.

    “A method for treating a psychiatric behavioral disorder of a patient, the disorder associated
    with a level of neuronal activity in a neural circuit within a brain of the patient, the method
    comprising:
    providing a light source that emits white light;
    filtering the ultra-violet (UV) rays from the white light;
    positioning the patient adjacent to the light source at a distance between 30-60 cm for a
    predetermined period ranging from 30-60 minutes to expose photosensitive regions of the brain
    of the patient to the filtered white light to mitigate the behavioral disorder.”

    That is blatantly just a claim that is trying to claim the abstract idea that filtered UV rays will mitigate a behavioral disorder associated
    with a level of neuronal activity in a neural circuit within a brain when directed to a photosensitive region of the brain from 30-60 cm for 30-60 min. And yet these tar rds declare it patent eligible because it doesn’t claim a natural phenom/law of nature. Sorry bro, still trying to patent on an abstract idea.

    They’re horrible at drafting good examples.

  85. suckie, just because (1) you haven’t the slightest understanding of biochemistry and molecular biology and (2) you have even less knowledge of patent law, which leaves you (3) unable to answer the questions I asked or (4) understand why those questions (or the many infinite variations thereof) are obvious … that doesn’t make me a blogtroll.

    It just makes you look like an idjit. Again.

  86. I don’t troll, suckie. I ask straightforward, obvious and clearly articulated questions that require no assumptions on your part.

    Contrast:

    Is it a “natural phenomena” if I find an identical sequence buried in the sex chromosome of a Chinese raccoon ten years after the patent is granted? What if the Chinese raccoon was raised in a lab? What if the Chinese raccoon was fed dog food? What if the dog food is mutagenic? What if I can only find it one Chinese raccoon? Fundamental and obvious questions, suckie

    W

    T

    F

    Malcolm, you are the sites’s biggest troll bar none.

  87. Why do you?

    I don’t troll, suckie. I ask straightforward, obvious and clearly articulated questions that require no assumptions on your part. The same questions that the clerks and judges will be asking in the Myriad case. The same questions that you never, ever answer, suckie, because you’re a sad troll.

  88. suckie There are many things in the Armitage brief that blah blah blah You cannot seriously be trying to blah blah blah.

    Non-responsive horsesh-t from suckie, per the usual. Please troll another blog.

  89. There are many things in the Armitage brief that are just plain insane.

    You cannot seriously be trying to hold a legal conversation with that brief as your starting point.

  90. “act or steps?”

    No definition of either that I can see.

    35 USC 112, p.6: “An element in a claim for a combination may be expressed as a means or step for performing a specified function without the recital of structure, material, or acts in support thereof, and such claim shall be construed to cover the corresponding structure, material, or acts described in the specification and equivalents thereof.”

    Seems that to be consistent with the ’52 Patent Act, that a step must be defined by the physical action (acts) it describes.

    This pretty much which Armitage said in his Amicus Brief.

    Thus, a claim describing a series of mental steps modifying one act would actually describe only one act. If that act was the only act in the claim, it would not seemingly be authorized by 112, p.6, which is limited to combinations.

  91. Lulz, more mistaken “guidance” from the office. Apparently they think the analsis is different for abstract ideas vs. laws of nature/natural phenom. Silly USPTO deputy commissioner. It isn’t.

    Could we please pay a little more to get a deputy commissioner who will actually tell the corps to apply the law rather than whatever absurd abomination of the law he can fiddle around with an make up himself?

    “Is the claimed invention directed to a process, defined as an act, or a series of acts or
    steps?
    If no, this analysis is not applicable. For product claims, see the Interim Examination
    Instructions for Evaluating Subject Matter Eligibility Under 35 U.S.C. § 101 issued August 24,
    2009. If yes, proceed to Inquiry 2.”

    Tardation. /facepalm.

    “While Mayo has provided additional details for the eligibility analysis that the Office developed after Bilski, the technology areas currently being addressed by the Federal Circuit, most notably in Myriad and Ultramercial, will provide insight regarding the full reach of Bilski and Mayo.”

    Lulz, as if you need more “insight” than the BFDBP saga provided you. How flipping rtarded do you have to be to need “more guidance”? The guidance provided is enough for a random 2nd grader to perform the analsis in like 95% of all cases. The remaining 5% is why we’rei professionals.

    “The Office believes that the prudent course of action is to wait for resolution of these cases before issuing comprehensive updated guidance.”

    /facepalm. Because it’s too hard to have a pair isn’t it?

    at the very least this travesty of a “guidance” paper manages to not bungle their primary topic of discussion, lawls of nature and natural phenom. They did a pretty good job touching on that.

  92. Malcolm, the authorities, in cooperation with the board, need to find out who made the decision to deliberately violated the law. If the board does not cooperate, they too should face jail time.

    Once the people who made the decision are identified, they should be prosecuted. Fines paid ultimately by the shareholders are not the right remedy, as they punish the wrong people.

  93. Mr. Little, what I am particularly sick of is you trolls constant misrepresentation of your own and others arguments.  You simply cannot and will not play it straight.  Moreover, I consider you and your kind borderline deranged.  

    It is truly about time that someone put a stop to the constant trolling by you and your fellow travelers.  

  94. link to bbc.co.uk

    The chairman resigns to save the CEO. The CEO makes a public threat to drag the central bank into the mire. And the previous government. And the Treasury. Next morning, the CEO resigns and the chairman re-installs himself to “oversee transition”. The police, who said they could not prosecute, now say they might.

    You have just seen the British establishment operating at a level of panic and indecision on a par with the Norway disaster in 1940. And it is not over.

    Clearly what the world needs is more patents to promote new methods of manipulating balance sheets.

    LOLOLOLOLOL.

  95. So your odd family (most people live in flyover country that your wife looks down upon) that makes more than examiner families would was already covered by the DC office.

    Did you have a point?

  96. In the largest financial penalty of its kind in the United States, drugmaker GlaxoSmithKline agreed to plead guilty to criminal charges and pay federal and state governments $3 billion to settle allegations related to inappropriate marketing of drugs, withholding of safety information, and failure to report accurate prices.

    Promote the progress!

    Seriously, patents aren’t necessary to promote new uses for old drugs. Big Pharma will do whatever it wants, when it wants.

    $3 billion dollars? Chump change. Cost of doing business. Vast numbers of rdinary people were hurt badly. But the important thing is that a few extraordinary people profited greatly at the expense of those ordinary people and none of those extraordinary people will suffer. Meanwhile, if an ordinary person breaks the fingernail of a clerk while trying to grab some lunch without paying for it, that ordinary person can look forward to jail time and a life-destroying criminal record.

    Great country, huh? God bless the United States of GlaxoSmithKline.

  97. link to uspto.gov

    Interim 101 guidelines, post-Prometheus:

    Under this analysis, the claim must be drawn to a process. A process is defined as an act, or a series of acts or steps.

    Looks like suckie is getting the short end of the USPTO’s stick. LOL.

  98. In fact I do have a wife and children, and have relatives in three of the cities you have listed. My wife would say no to the cities you have listed. She likes northeast, midatlantic and west coast, even though the housing dollar does not go as far.

  99. No actual real discussion where negative points need be even acknowledged at all.

    Remember when suckie’s favorite blogger (woof!woof!) acknowledged that practitioners of the prior art became infringers merely because they thought about the correlation recited in Prometheus’ claims?

    Neither do I.

    LOL.

  100. You do realize that I approve wholeheartedly of this holding?

    contrast

    And 102/103 are perfectly adequate for cleaning up the difference

    W

    T

    F

    Seriously MM? Your way of showing that you approve wholeheartedly of this holding is to advise against it?

  101. suckie natural phenomena

    What is exactly is a “natural phenomena”, suckie? How do I know if a composition of matter is a “natural phenomena”, suckie? What’s the test, suckie?

    How about the following isolated nucleic acid sequence:

    ACGTTTGTTCGCGCGTTAGATCTAGCATTTAGAGCGGATATAGCGCGATATTTTATATTATATTGCGCGCGATGCTCGTAGCTCGTCGATATAGATATAATCXGCTA

    How do I know if that is a “natural phenomena” or not, suckie? Please share your enlightenment with us.

    Is it a “natural phenomena” if I find an identical sequence buried in the sex chromosome of a Chinese raccoon ten years after the patent is granted? What if the Chinese raccoon was raised in a lab? What if the Chinese raccoon was fed dog food? What if the dog food is mutagenic? What if I can only find it one Chinese raccoon?

    Fundamental and obvious questions, suckie. Almost as fundamental and obvious as this question: why do you troll?

  102. suckie: In particular, it argues that these claims likely fail for lack of novelty under §102. This approach, however, would make the “law of nature” exception to §101 patentability a dead letter. THE APPROACH IS THEREFORE NOT CONSISTENT WITH PRIOR LAW.

    You do realize that I approve wholeheartedly of this holding?

    You also apparently do not realize that, in view of Prometheus, the “law of nature” exception to 101 patentability is in no danger of being characterized as a “dead letter”. If you are having difficulty understanding why that is the case, pick up your phone and call Prometheus and ask them about the current rates for licensing their [oldstep]+[newthought] claims.

    Most importantly, you have proven yourself incapable of articulating a “product of nature” test that is both (1) distinct from anticipation and (2) doesn’t render every chemical composition ever created by man susceptible to destruction by application of your test. In light of that fact, you really to GFY, hard, like it was your first time instead of your thousand time.

  103. So says the single largest pollutor of the planet.

    Oh, he means legal discussion of only his agenda. And by discussion, Ned means monologues. No actual real discussion where negative points need be even acknowledged at all.

    Nevermind.

  104. 9-0 Baby, Yeah!

    101 them all, processes, compositions, machines and manufactures. The subject matter courts have found to be outside of, or exceptions to, the four statutory categories of invention is threefold:
    1) abstract ideas,
    2) laws of nature, and
    3) natural phenomena.

    Just as a refresher, natural phenomena are NOT laws of nature. The Court has chosen its words carefully and did not say that there are TWO exceptions. They said THREE exceptions, and they meant it.

  105. Mr. King, just one more example, just one, of missing the point, erecting a strawman, and/or attempting to derail the conversation.

    Either that, or you just can’t read.

  106. And, the bulk of humanity would like you trolls to just vanish. Your pollution of any otherwise decent forum for legal discussion is beyond all tolerance.

  107. And 102/103 are perfectly adequate

    Breyer’s aides must have lost those notes on the way to writing this in Prometheus:

    But in its view, other statutory provisions—those that insist that a claimed process be novel, 35 U. S. C. §102, that it not be “obvious in light of prior art,” §103, and that it be “full[y], clear[ly], concise[ly], and exact[ly]” described, §112 — can perform this screening function. In particular, it argues that these claims likely fail for lack of novelty under §102. This approach, however, would make the “law of nature” exception to §101 patentability a dead letter. THE APPROACH IS THEREFORE NOT CONSISTENT WITH PRIOR LAW. The relevant cases rest their holdings upon section 101, not later sections. Bilski, 561 U. S. ___; Diehr, supra; Flook, supra; Benson, 409 U. S. 63. See also H. R. Rep. No. 1923, 82d Cong., 2d Sess., 6 (1952)… And to shift the patent eligibility inquiry entirely to these later sections risks creating significantly greater legal uncertainty, while assuming that those sections can do work that they are not equipped to do… These considerations lead us to decline the Government’s invitation to substitute §§102, 103, and 112 inquiries for the better established inquiry under §101“.

    MAYO COLLABORATIVE SERVICES, DBA MAYO MEDICAL LABORATORIES, ET AL., PETITIONERS v. PROMETHEUS LABORATORIES, INC., 566 U. S. ____ (2012) at 20-22. (emphasis added).

    Those are some carefully chosen words, not to be ignored. Let’s celebrate what a great decision Prometheus is!

  108. JM&J, another thread contaminated by the runaway let’s-make-up-new-law-and-never-answer-questions duo of Frick and Frack.

    Can’t we just get these guys a room?

  109. if we subject the natural compound to a process that renders it into a useful form, isn’t that all that should be required for 101 purposes?

    I believe you are correct, Ned.

    And 102/103 are perfectly adequate for cleaning up the difference (in stark contrast to [oldstep]+[newthought] claims, which would be patentable in every instance where [newthought] is non-obvious absent the creation of a new and unnecessary legal doctrine that would allow one to ignore the [newthought] limitation when considering patentability under 102/103).

  110. Product of Nature vs. Utility

    Compositions of matter found in nature are not (normally) useful in that form. Iron has to be smelted. Adrenalin has both to be extracted and purified. Ditto heavy water.

    Thus, aside from a prior art issue involving known compositions, isn’t the product of nature exception as we think we know it from Chakrabarty the same thing as a utility exception?

    Thus, if we subject the natural compound to a process that renders it into a useful form, isn’t that all that should be required for 101 purposes?

  111. Vegas, St. Louis, Kansas City, Phoenix, Reno…

    You don’t have a family, do you? It’s easy to attract families to places that they can afford to live and have good stuff for family entertainment and outdoor recreation. If your family can’t afford to live there, your wife ain’t having it. Good luck recruiting when the wife says no.

  112. It shouldn’t be hard to hire Examiners in Silicon Valley. Just find people who fail in engineering or private practice patent law, or those who prefer to smoke pot all the time. Then offer them a really high government salary and you’re set.

  113. Cost of living — it would be extremely difficult to attract examiners and their families to live in like low cost places like Waco, TX and Fayetteville, AK. Plus they are not convenient to the customers.

  114. “I dare say that some of the Electrical examiners I’ve dealt don’t seem to have the depth of knowledge in the field that is typically required of electrical engineers at high-tech companies in the US. ”

    I lulzed. Nice qualifier “some”.

  115. EEs who enjoy writing go to law school and become patent attorneys, not just for the money but also for the intellectual challenge. Such people do not find the work at the PTO to be stimulating enough. The PTO will never be able to hire and retain the kind of people who make excellent examiners.

  116. I dare say that some of the Electrical examiners I’ve dealt don’t seem to have the depth of knowledge in the field that is typically required of electrical engineers at high-tech companies in the US. The PTO will continue to hire only those who will stay for a year or two and then finish law school and those who can’t hack it in the private sector.

  117. In fact, I have lived for many years in the DC area, and have an elderly relative who is sitting in a dark hot house now in the DC area.

    And why can’t the PTO arrange to have hours which accommodate those practicing in the Pacific Time Zone?

  118. I have several European clients and associates that I have to call BEFORE noon if I want to speak with them. OMG the humanity!!!!!

    I seriously doubt there is anything you need to speak with somebody at the PTO about that is so time sensitive that it can’t wait until tomorrow. I’m in the same time zone as the PTO and I can’t think of anything in the past 13 years that I needed an answer for that day.

    I’m good friends with the supervisor of the PCT Legal Administration. I’ll give you his home phone number if you’re that desperate.

    I haven’t experienced any power outage. Had a high of 88 yesterday. It’s beautiful here. Try it, you might like it.

  119. “All three of these locations, have considerable higher cost of living and therefore, will require higher compensation than many of the other possible alternatives.”

    Examiner are all paid the same no matter the location. We’re on a special payscale. link to usptocareers.gov

    P.S. You must not be from the area. Alexandria has a higher cost of living than Denver and Houston. San Jose has a slightly higher cost of living. I suspect that quality examiners are going to be hard to find in San Jose when examiners start at GS-7 or GS-9 (though many current examiners may move to CA and hotel from cheaper areas of california, then drive up to San Jose for the quarterly reporting requirement).

  120. and therefore cost efficiency of the patent office, did not play a factor in this selection

    Why should it? With the AIA, the Office has full authority to recapture whatever costs it incurs and pass that innovation tax to the users of the patent system.

  121. It is obvious that, other than Detroit, the cost of living factor, and therefore cost efficiency of the patent office, did not play a factor in this selection. All three of these locations, have considerable higher cost of living and therefore, will require higher compensation than many of the other possible alternatives. I guess the patent office is flush with cash that they need to spend.

  122. Dear Mr. Sarcasm:

    Frequently questions/issues do not arise until afternoon, or maybe I/we are tied up in the morning in out-of-the-office meetings.

    I have been managing, just barely, for 30 years in private practice.

    PTO should be a little bit more customer responsive sometimes.

    How do you like the heat, humid and power outages back east?

  123. [wield] the 101 hammer

    Like Mjölnir, only if he be worthy, shall he possess the power of Thor.

    And to paraphrase Senator Lloyd Bentsen,

    6, I served with Thor, I knew Thor, Thor was a friend of mine. 6, you are no Thor.

  124. Silicon Valley still hosts bleeding edge research in areas such as integrated circuit design, magnetic recording, and many related technologies. Not every invention made here is related to an improved user interface.

  125. I have some authentication and database management applications. To someone with no understanding of the art, they may appear to be an obvious variation. But when one unstanderstands the state of the art, doing something in contravention of best practices to acheive a desired effect is usually far from obvious.

  126. “Likewise, it does not require an EE degree to search applications for icon displays, finger swipes, or rectangular shaped electronic objects with rounded corners and beveled edges. ”

    That’s true, but it does take a EE to 101 them.

    “Being able to read flow charts and algorithms and do good Google and business literature searches, and hopefully some basic digital programming, might be sufficient and more useful for those many patent applications than someone who can do the math for waveform analysis, electic motors or transmission lines, and circuit designs? Not ”

    I will have to disagree, respectfully. Being able to weild the 101 hammer is > all in this situation. And non-EE’s can’t weild the 101 hammer you silly goose!

  127. As an old obsolete EE, I wonder if a true EE education is really needed for examiners searching for prior art and examining all those applications these days that are “electrical” only in the sense of calling for some kind of software implimentation (especially business methods). How often do such applications go into code details of the software, much less the electrical circuitry or chemical mfg. details of the chips that software runs on? Likewise, it does not require an EE degree to search applications for icon displays, finger swipes, or rectangular shaped electronic objects with rounded corners and beveled edges.
    Being able to read flow charts and algorithms and do good Google and business literature searches, and hopefully some basic digital programming, might be sufficient and more useful for those many patent applications than someone who can do the math for waveform analysis, electic motors or transmission lines, and circuit designs? Not to mention competence in English and English comprehension, which, as often noted, has not been a PTO examiner critera.

  128. How do you manage to carry on against such overwhelming and seemingly insurmountable challenges as having to call very early in the afternoon??!!

  129. “That wouldn’t change at all. You would still have to call the Alexandria offices.”

    They should change that then. I hope PTO decision makers read this.

  130. I do not understand your response. I was agreeing with what I thought was your tongue in cheek post at 9:06 AM.

    I do not think that it is “the examiners” at the PTO that is the problem. They are like lemmings, following what the entrenched management at the PTO tell them to do, following the ringing bell like Pavlovian dogs.

    To address the issue, you do not focus on the dogs. You focus on those ringing the bell.

  131. Just a little bit of semantics here, but the work-from-home program is called hoteling. The satellite offices will serve as check-in support for hoteling employees, who are distinguished from regular telework employees.

    Teleworking is a type of work-from-home program but the difference is that telework employees have not changed their work site to their homes. They are approved to work from home on a limited basis, compared to hoteling employees who work from home basically all the time.

  132. You assume that that model has changed. It has in some art units, but many of those rejectors are still employed as examiners at the PTO.

  133. That was tried and failed.

    All that resulted was the workload got transfered into bigger piles of RCE and Appeal backlogs.

    The attempted fix was for the Office to try and limit the number of RCEs that an appplicant could undertake as a matter of right (Taffas) or make the Appeal process so burednsom enad capricious as to dissuade that path (rejected Appeals rules package).

    This has been well chronicled and is old news.

  134. Why does the PTO need EE’s anyway? Anyone can write a series of boilerplate non-sensical rejections. Just start with 101, then do a 103 based on … anything. Problem solved, backlog gone.

  135. “the PTO either needs a way to get EEs more confortable with ‘natural’ language.”

    Don’t worry … there is no requirement that a USPTO examiner have good writing skills. Know that most sentences starts with a capital letter and end with a period? Yes? … you are hired. No?? … well, we can teach you that.

  136. Since the AIA has incentives for EFS filing, and they scan and toss everything that’s not EFS, you’ll probably just send it all to DC, and the Examiners will access it when scanned.

  137. That wouldn’t change at all. You would still have to call the Alexandria offices.

    The only thing these branch offices are good for are for teleworking examiners so that they don’t have to visit Alexandria once a quarter. It makes teleworking from nicer areas like denver and California possible.

  138. I wonder how mail will be addressed in the future. Everything sent to Alexandria and then shipped out from there? Or sent to the nearest center, or what?

  139. Interesting – when Director Kappos visited SiVal last year, he said a “regular” PTO satellite office here (as much logistical sense as it might make) would be too economically challenging. (Our cost of living – anywhere within about 60 miles of the Bay – is exceeded only by the likes of Tokyo and midtown Manhattan). He talked about putting a patent-appeals center here instead. Wonder what changed?

    Here’s why I think the PTO might be having trouble getting enough EE Examiners: I’m an EE and I LOVE to read and write! From meeting many, many other EEs over a long career on both sides of patent law,* I’ve gathered that it’s kinda like being a house-cat who loves to swim – not unheard of, but pretty uncommon. Many EEs are smart as anything, but literarily arranged words aren’t their medium. They think in programming code, or images, or equations, or multidimensional vector spaces with particles and waves propagating everywhere.

    So the PTO either needs a way to get EEs more confortable with “natural” language (I know, using that term to describe patentese is a stretch), or find a way to assist some of our very sharp (and shamefully underemployed) electronics tech writers through the formal EE coursework hoops required to sit for the Patent Bar.

    ___________

    *By “on both sides of patent law” I mean I was an inventor before becoming a practitioner; I don’t mean I went around helping people infringe on purpose or anything :)

  140. “In addition, the satellite offices are expected to include high-quality teleconferencing equipment that patent applicants can use to conduct examiner interviews and argue appeals even when decision makers remain in DC.”

    It’s similar to skype except worse.

  141. ” A major open question is whether the USPTO will have the ability be able to hire and retain high-quality electrical engineers to staff its silicon valley patent office.”

    Maybe the PTO can provide EE training to high-quality Mechanical Engineers in Silicon Valley?

  142. It will be a positive development to have an office in the Pacific Time Zone. For example, those of us on the West Coast who have questions and call the technical offices or the pct help desk now must do so very early in the afternoon, our time.

Comments are closed.