By Dennis Crouch
The US Supreme Court has decided a number of patent cases that raise questions of unenforceability. Perhaps most notable among these are:
- Keystone Driller Co. v. Gen. Excavator Co., 290 U.S. 240 (1933);
- Hazel-Atlas Glass Co. v. Hartford-Empire Co., 322 U.S. 238 (1944); and
- Precision Instrument Mfg. Co. v. Auto. Maint. Mach. Co., 324 U.S. 806 (1945).
This trio of cases explains that inequitable conduct fits within the scope of the traditional equitable doctrine of unclean hands.
Keystone involved a patentee paying another party to lie about its prior use of a patented invention where that use might have been a prior public use. Similarly, in Hazel-Atlas, the patentee wrote an article and had it published under the name of a well-known expert (with the expert's consent). After seeing how the article lauded the invention (and without knowing the connection), the PTO was willing to issue the patent. Precision involved perjury in the course of an interference proceeding. In each of these cases, the Supreme Court held that that the unclean hands doctrine could be used to render the patent unenforceable.
For many years, the doctrine of unclean hands (and, as we call it now inequitable conduct) was a powerful in-court tool for accused infringers to challenge patent enforcement. Almost since the Federal Circuit beginning, Federal Circuit judges have been on a crusade to limit the doctrine. The court's most recent pronouncement found in Therasense, Inc. v. Becton, Dickinson & Co., 649 F.3d 1276 (Fed. Cir. 2011) (en banc) continues this trajectory and strongly limits the scope of inequitable conduct allegations.
In Therasense, the Federal Circuit offers two pathways for proving inequitable conduct in the patent prosecution process. The first and primary pathway clear and convincing proof of (1) intentional misconduct and (2) that the misconduct is a but-for cause of the patent issuing. As shorthand, we speak of (1) intentionality and (2) materiality. The Therasense majority, also offered a second pathway for proving inequitable conduct based upon "egregious affirmative acts of misconduct." According to the court, the mere non-disclosure or omission of required information will always fit within the primary pathway while intentional affirmative misstatements that go beyond attorney argument could fit within the second pathway if sufficiently egregious. In reading the trio of Supreme Court cases, the Federal Circuit found that Keyston, Hazel-Atlas, and Precision all fit the definition of egregious misconduct.
Writing in dissent Judge O'Malley criticized the majority opinion as unduly rigid in its formulation of the unclean hands doctrine.
[B]oth the majority and [other] dissenting opinions eschew flexibility in favor of rigidity. Both opinions suggest tests for materiality to apply in all cases. Their respective materiality inquiries are black or white, while equity requires judicial consideration of shades of gray.
The majority defines materiality under a but-for test, with an exception for intentionally false affidavits filed with the PTO. The dissent, on the other hand, defines materiality according to Rule [37 C.F.R. 1.56]. Both tests fail to provide district courts with flexibility to find inequitable conduct in an extraordinary case where the conduct in question would not be defined as such under either test. This result is contrary to the very nature of equity and centuries of Supreme Court precedent. I cannot, accordingly, lend support to either of the immutable tests proposed by my colleagues.
= = = = =
Sony Computer v. 1st Media LLC (on petition for writ of certiorari 2013)
In a recently filed petition for writ of certiorari, Sony and Viacom have asked the Supreme Court return the law to the flexible tests of its old precedent. Raising the following question:
Did the Court of Appeals for the Federal Circuit err in restricting district courts' equitable discretion in evaluating patent unenforceability, contrary to this Court's precedent in Keystone Driller, Hazel-Atlas, and Precision Instrument, by applying a rigid test that (a) forecloses district courts from considering the entire circumstantial record; and (b) precludes district courts from granting equitable remedies where a patent applicant has violated the PTO's duty of candor.
The Federal Circuit intended that the second pathway for egregious misconduct add sufficient flexibility to fit within the Supreme Court's doctrine. Sony responds that the limited carve-out "is flawed because it creates a rigid threshold [of an egregious affirmative act of misconduct] as a prerequisite to the equitable discretion called for by this Court's precedent. The flexibility embodied in this Court's precedent should apply in all cases, not just those involving affirmative egregious misconduct."
Read Sony's Petition: Download 1st Media Certiorari Petition
Nice non-sequiturs.
LOL – say bye bye to anything that is effectively a product of nature (9-0 Prometheus baby).
I think justice should always err heavily on the side of presuming innocence.
The equitable prosecution of the patent is presumed. As for “innocence”, the parties involved in the prosecution of the patent are not on trial and they are hardly ever punished as a result of the court’s inequitable conduct findings so in that practical sense your dream has come true.
As a reminder, patent attorneys get fired all the time, every day, for offenses far less egregious and far more egregious than those which lead to inequitable conduct charges. It’s a stressful job. That’s why it pays pretty well.
it’s not really any more j–k than your c-dna gene claims
My cDNA claims? I don’t have any cDNA claims.
Here’s a claim for you:
1. A chemical composition, wherein said composition consists of the following sequence of deoxyribonucleic acids: ACGTGTTGAAAGTGTGTCCGGCGTAGAAGAGAGGATCCGTCTTGTGTGTCCGCTAGAGAGAGAATGAGTAGAATGATGCGGGGCCCCGAACGATGATGATGTGTGTGGGTGTGCCGTGTGCTAGTAGATGTGAGAGAGAGGAG.
Let me know if that’s “junk” or not. Thanks.
Your irrelevance is spectacular.
It might be unavailing at convincing a tar d like yourself, but it has availed me every single time in the the last 5 years or so in prosecution.
But look on the bright side, when you are no longer a ta rd it will avail me in the instant convincing of you.
Your attempt(s) at semantics is unavailing.
as I note below, functions are what something does. steps are what something is doING right now. This claim blatantly recites what the thing is supposedly doING right now, not what it does.
nah bro, these are “means plus step being performed” claims.
functions are what something does.
steps are what something is doing right now.
Congress may very well be moving in that direction, after all, patent attorneys are constantly jibbering in their ears whereas the people harmed by the “without deceptive intent” actions performed are probably not jibbering quite so much.
In either event I support the unclean hands notion more than the current one.
WO 86/02224 (Williams) claims
A closed circuit television system for a public building, comprising:
a stage provided with an in-built control station for the television system at which an operator visible to at least one part of an audience in different areas of said building is provided with a plurality of sources of video entertainment material including sources of recorded material under his control,
means enabling the operator to select required signals from said sources and to modify said signals , and
switching matrix means by which the operator can feed output signals selectively to a multiplicity of distribution amplifier means whose outputs are fed to the several areas of said building in which different parts of the audience are located.
The said apparatus was installed in the basement of the Palladium theatre in central London where it formed a centrepiece of the so-called VIDEO CAFE which was an innovative but unfortunately short-lived venture.
Some of the technology was borrowed from a video juke-box devised by a company called V I Leisure. Their patent GB 2122799 claimed:
Apparatus for retrieving and playing selected individual sequences of moving pictures comprising:
a tape player operable with a tape having one track for recorded video information, a first audio track for sound to be reproduced with the video information and a second audio track recorded with frequency shift keyed tones defining digitally encoded position numbers incrementing along the tape, said tape player in normal play providing video and audio outputs together with a tones output and in fast forward or rewind providing output pulses indicating tape motion;
a continuously available source of video information;
a monitor for displaying the audio and video information from the tape player and the video information from said source;
a first random access memory for storing information stream identifiers and their start and end position numbers;
input means including a coin mechanism and a keyboard and operable on receipt of a credit to enable identifiers to be supplied corresponding to selections to be played; and
control means operable to cause the monitor to display the video information from the continuous source when the tape player is other than in normal play, operatively connected to the tape player to place it in fast forward or rewind while receiving said output pulses and to place it in normal play while receiving and decoding said tones to derive tape position numbers and responsive to an identifier to compare the current position number with the pertinent start position number from said first random access memory, to move the tape in fast forward or rewind in response to said output pulses to a position before the start of the selected sequence, to place the tape player in normal play and to cause the information stream to be displayed on the monitor while the tape position is between said start and end numbers.
Allowing for the now antique technology, there is really not much in this claim.
“Sneaking a method step into an apparatus claim is one of the easiest ways to get the claim allowed. All of the serious people in the relevant art will not disclose any apparatusmethods”
6 – these are explicitly means plus function claims. If, as you allege, all of these ‘serious’ people do not disclose any ‘apparatusmethods,’ then these should be the easiest claims to examine and sustain rejections for.
Are you saying that examiners are simply not doing their jobs?
“sooooo harsh the patentee’s buzz”
LOL – pray tell where is this idiom from?
Really 6? Shouldn’t you of all people understand the concept behind means plus function claim formatting?
And Chef America has nothing to do with this – how vacuous.
6,
What then do you make of Comgress’ actions in stripping out ‘deceptive intent’ from the law?
Congress appears to be moving in the opposite direction from you.
In all fairness, it’s not really any more j–k than your c-dna gene claims.
hey guys, a quick question on search strategeries that you guys use or recommend that has actually been on my mind for quite awhile.
Let us say that the invention is some sort of method of making a semi-specialized device, just as an example, perhaps a state of the art bicycle with some sort of aero dynamic fins on it or something. But let us say that the method of making those fins involves a specialized process in and of itself. Let us just say that you form those fins by a specialized welding process that adds tiny ridges in the fins that make them even more super awesome.
The applicant chooses to claim the specialized process of forming aero-dynamic fins along with the specific welding steps required. He leaves out any mention of actually forming the bike or forming the fins on a bike.
My question for you is, considering for this example that the classification provides for methods of making bikes with aero-dynamic fins in one subclass and it provides for methods of making fins by welding in a separate subclass that comes later in that same class (thus we’re pretty sure it gets classified in the later class), DO YOU GO AHEAD AND LOOK IN THE BIKE SUBCLASS for your search or not?
“an innocuous technical error.”
I haven’t looked at any prosecution, but I will bet you good money that this method step is included in the reasons for allowance.
It is actually rather hard to find disclosures of apparatusmethods. Sneaking a method step into an apparatus claim is one of the easiest ways to get the claim allowed. All of the serious people in the relevant art will not disclose any apparatusmethods so the prior art available prior art is always slim.
Man, it would sooooo harsh the patentee’s buzz to flush an otherwise awesome invention down the twalet for such an innocuous technical error.
LONG LIVE CHEF AMERICA!!!!!!
POWERFUL COMPUTAR BRAIN!
“the receiving means also receiving information concerning the cost of the one song from the storing means”
I smell a method step in an apparatus claim.
101/112.
“I think not”
I rather thank that it does actually. If you wish to have a legal right to be able to exclude other people from doing otherwise perfectly legal things then you better da rn well be proactive about being up front and honest about things.
If you can’t be responsible about it, then you don’t really deserve the patent grant in the first place.
From my perspective where “the problem” lies is in having the attorney, rather than the applicant himself, determine what art to submit and actually do the submitting. That way the attorney is not involved and you guys don’t have to qq. The end of your responsibility should be saying “here fill out this form for patent literature you think is material and get a stack of NPL to send in and send it in”. But in lawyer’s zealousness to take over the entire proceeding we end up with them on the hook for keeping track of references to submit and what have you. But then, that is the problem with most of today’s legal system. Lawyers.
“If you’re doing your job well, you have nothing to worry about.”
I *hope* this is true — but with the vast majority of defendants alleging IC almost as matter of routine, it seems likely that some of the false charges will stick if the bar isn’t quite high. And even a small-but-significant chance of that happening creates undue settlement leverage, etc.
I agree that a lot of applicants (sadly) get away with cheating, but I think justice should always err heavily on the side of presuming innocence.
It seems to me that if we’re moving so much toward a EPO-style system anyway (for better or for worse…), then we too can just trust in the other mechanisms (e.g. PGR/oppositions) to avoid the need for IC at all.
Alun, please note my post at 8:36 PM – even what was in the law regarding “with deceptive intent” has been removed by Congress with the AIA.
What are your thoughts on that?
“Inequitable conduct can be supported by a reference that’s a ‘near miss,’ it doesn’t have to actually be invalidating prior art.”
This was only true before “but-for,” right?
“reexam only gets individual claims”
So would that make reissue a better way to “cure” IC, since anything that survives reissue by definition passes muster on a “but-for” standard? My understanding is that reissue let’s you just point out any one error (however trivial), not all errors, plus unlike reexam you don’t have to in essence make a case against your own patent (i.e., SNQ).
“inequitable conduct kills the whole patent (and can kill related patents in the family).”
Doesn’t an IC case have to be made against each “patent” (albeit not each claim) individually? What about a continuation having claims and/or an IDS that would make it not IC?
Does accidental omission of prior art, without deceptive intent, fall within the general and venerable unclean hands doctrine? I think not, and yet in the past it had been considered inequitable conduct, and therein lies the problem.
Thanks for the response. Good points. But are the remedies exclusive? By that I mean, could Sony have filed for a reexam while still maintaining its inequitable conduct defense at trial?
Why inequitable conduct instead of reexam? Lots of reasons.
Because reexam only gets individual claims, inequitable conduct kills the whole patent (and can kill related patents in the family).
In reexam, the patentee is free to amend the claims to be “just right” narrow around the prior art but still broad enough to cover the accused product. A patentee can’t amend claims to defend an inequitable conduct issue.
Inequitable conduct can be supported by a reference that’s a “near miss,” it doesn’t have to actually be invalidating prior art. Reexam is only effective if the prior art you have kills the specific claims that cover the accused product.
A patent is a potent competitive weapon. The law makes sure you play fair to get it.
without a showing the claims are invalid, i.e., read on the prior art, I don’t know just how one can KNOW that one claims are invalid over the prior art.
I don’t think that “showing” will be very difficult as these claims are complete piles of j–k.
5,464,946
1. An interactive music listening entertainment system comprising:
means for storing a plurality of songs;
means for selecting one of the plurality of songs from the storing means;
means for transmitting the one song down a network;
and means responsive to the selecting means for receiving the one song from the storing means by a recipient;
the receiving means also receiving information concerning the cost of the one song from the storing means and including means for limiting the number of plays for the one song based on the encoding of the one song by the receiving means.
It’s a jukebox with a POWERFUL COMPUTER BRAIN.
MM, the problem with PTO discipline was a 5year SOL. I think that has been corrected in the AIA.
The only thing I can see that might be unclean hands is the statement that a reference did not have the MCPS feature that the attorney “knew” to be in a different reference cited in a related case. Even this can be explained.
However, that does not seem to be the basis of the petition.
I for one do not see how simply failing to disclose references is unclean hands. Filing claims that one knows to be invalid over known prior art may be — but without a showing the claims are invalid, i.e., read on the prior art, I don’t know just how one can KNOW that one claims are invalid over the prior art.
Paul,
Are you asking why Sony didn’t file for re-exam, or why the patentee didn’t file for a re-exam?
In either case, it seems that a re-exam would have been the way to go.
I wouldn’t be too surprised to see another bright line rule from the Fed. Cir. shot down by SCOTUS. If that happens, I’m going to have to agree with Ned that it may be time to get rid of the Fed. Cir. and give the patent appeal jurisdiction to the DC circuit.
“far, far less than the number of people who intended to deceive the USPTO and got away with it”
LOL – all those people ripping off software, right?
“You play with fire, sometimes you get burned”
Or in Malcolm’s case, he ventures into substantive law.
“you have nothing to worry about”
Rather misses the point. Badly.
I really hope the Supremes don’t reinstitute “the plague.”
Reminds me: is there any data showing that the alleged “plague” of inequitable conduct defense pleading has subsided in a substantial fashion? In absolute numbers, I would expect that defense to be pled more often than ever now. It’s difficult to win but not impossible, particularly if the accused makes a terrible witness.
how many good people have had their names dragged through the mud over such things?
I don’t know but I’m certain that the number is far, far less than the number of people who intended to deceive the USPTO and got away with it. In any case, hardly anyone cares about this “mud”. Remember those sleazy guys who were found to have engaged in inequitable conduct in the Therasense case? Me neither. Were they punished by the USPTO? I doubt it. In fact, they were good soldiers who did what they were told and succeeded at least in their goal of antagonizing a competitor for years with their patent. The term in the art is “zealous advocacy.” You play with fire, sometimes you get burned.
I don’t want to go back to having to be so paranoid.
Then don’t. If you’re doing your job well, you have nothing to worry about.
Good points.
But the conduct alleged in this particular cert petition may be appealing for cert, and difficult to excuse if true – that the ex parte prosecution attorney never cited ANY prior art references, not even the EPO references cited against their EPO equivalent, which they were aware of, or related cases.
I have to ask my usual question, which is: if these uncited prior art references are really that good, why in heavens name did not the clients attorneys, in-house or otherwise, ask to promptly file a reexamination, to potentially save several million dollars and to also remove any issue of “materiality” for IC here?
[I hope someone on the Sup. Ct. reviewing this cert petition, or in oral argument if it is granted, will also think to ask that question, but I doubt it.]
off now?
off
I really hope the Supremes don’t reinstitute “the plague.”
It was so agonizing (pre-Therasense) for many of us to try to figure out where to “draw the line” about when to stop throwing likely-immaterial references into the IDS, just for fear of an unfounded (yet often at least partly effective regardless, if only strategically…) accusation of IC just for the off-chance that somebody might subjectively deem it material, which in turn gives defendants leverage they don’t really deserve, and presents plaintiffs with an unfair risk (not to mention huge unwarranted discovery costs) that they cannot afford. And how many good people have had their names dragged through the mud over such things? Litigators have even told me that it often became considered *malpractice* to NOT allege IC, regardless of merit, due to its raw power (combined with the regrettable toothlessness of Rule 11, etc.). Not to mention all the often lamented concerns about foreign and co-pending domestic applications — geesh, it’s just so easy to honestly miss something and then be stuck trying to prove a lack of intent, and it’s wrong to make us worry unless it *really* matters.
I was finally able to breath easy knowing that if it wasn’t truly material then it’s not a concern. I don’t want to go back to having to be so paranoid.
As both an inventor and a patent prosecutor, I truly do want my IDSs to be as thorough as possible, so that my patent is as robust and “reexam-proof” as possible. I just think we’d do better to focus on more rigorous examinations rather than subjecting applicants/attorneys to the pre-Therasense plague.
Nice leap of imagination there, from Scottish (?) McCracken. But does the Doctrine really originate with Lady Macbeth’s little hand that will “ne’er be clean”? I doubt it.
Not quite sure what Good King Duncan has to do with inequitable conduct. On the other little hand though, take that ambitious fellow Macbeth. Calling his conduct “inequitable” doesn’t quite capture the seriousness, does it?
What need we fear who knows it, when none can call our
pow’r to accompt?—Yet who would have thought the old man to
have had so much blood in him?
How does the AIA “purging” of patent law (removing ‘without deceptive intent’ throughout) intersect with the CAFC decision?
Won’t the Supreme Court take this as an affirmation of the CAFC’s position?
“doctrine of unclean hands”
Funny how it went from that to the nonsense “but for” standard that is in place today.
Comments are closed.